Gene Page: STRN4
Summary ?
GeneID | 29888 |
Symbol | STRN4 |
Synonyms | ZIN|zinedin |
Description | striatin 4 |
Reference | MIM:614767|HGNC:HGNC:15721|Ensembl:ENSG00000090372|HPRD:18125|Vega:OTTHUMG00000183432 |
Gene type | protein-coding |
Map location | 19q13.2 |
Pascal p-value | 0.212 |
Sherlock p-value | 0.32 |
Fetal beta | 0.006 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:vanEijk_2014 | Genome-wide DNA methylation analysis | This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). | 3 |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 3 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0631 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg12254611 | 19 | 47249193 | STRN4;FKRP | 3.448E-4 | -0.233 | 0.041 | DMG:Wockner_2014 |
cg06095560 | 19 | 47633912 | STRN4 | 0.001 | 3.687 | DMG:vanEijk_2014 | |
cg11822964 | 19 | 47129337 | STRN4 | 5.988E-4 | -3.649 | DMG:vanEijk_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs36781 | chr5 | 109289728 | STRN4 | 29888 | 0.14 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005516 | calmodulin binding | TAS | 10748158 | |
GO:0005198 | structural molecule activity | TAS | 10748158 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007268 | synaptic transmission | TAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 10748158 |
GO:0007165 | signal transduction | TAS | 10748158 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005624 | membrane fraction | TAS | 10748158 | |
GO:0005737 | cytoplasm | TAS | 10748158 | |
GO:0016020 | membrane | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
AK5 | AK6 | MGC33326 | adenylate kinase 5 | Two-hybrid | BioGRID | 16169070 |
ASNS | TS11 | asparagine synthetase | Two-hybrid | BioGRID | 16169070 |
BAT1 | D6S81E | DDX39B | UAP56 | HLA-B associated transcript 1 | Two-hybrid | BioGRID | 16169070 |
CAV1 | CAV | MSTP085 | VIP21 | caveolin 1, caveolae protein, 22kDa | - | HPRD | 11707266 |
CLDN12 | - | claudin 12 | Two-hybrid | BioGRID | 16169070 |
CTTNBP2 | C7orf8 | CORTBP2 | FLJ34229 | KIAA1758 | MGC104579 | Orf4 | cortactin binding protein 2 | Affinity Capture-MS | BioGRID | 18782753 |
CTTNBP2NL | DKFZp547A023 | FLJ13278 | CTTNBP2 N-terminal like | Affinity Capture-MS | BioGRID | 18782753 |
ECSIT | SITPEC | ECSIT homolog (Drosophila) | Two-hybrid | BioGRID | 16169070 |
FAM40A | FLJ14743 | KIAA1761 | MGC148091 | RP4-773N10.1 | family with sequence similarity 40, member A | Affinity Capture-MS | BioGRID | 18782753 |
GDF9 | - | growth differentiation factor 9 | Two-hybrid | BioGRID | 16169070 |
KLHDC2 | HCLP-1 | LCP | kelch domain containing 2 | Two-hybrid | BioGRID | 16169070 |
MCC | DKFZp762O1615 | FLJ38893 | FLJ46755 | MCC1 | mutated in colorectal cancers | Affinity Capture-MS | BioGRID | 17353931 |
MOBKL3 | 2C4D | CGI-95 | MGC12264 | MOB1 | MOB3 | PREI3 | MOB1, Mps One Binder kinase activator-like 3 (yeast) | Affinity Capture-MS | BioGRID | 18782753 |
MTG1 | GTP | GTPBP7 | RP11-108K14.2 | mitochondrial GTPase 1 homolog (S. cerevisiae) | Two-hybrid | BioGRID | 16169070 |
NBEA | BCL8B | LYST2 | neurobeachin | Two-hybrid | BioGRID | 16169070 |
PDCD10 | CCM3 | MGC1212 | MGC24477 | TFAR15 | programmed cell death 10 | Affinity Capture-MS | BioGRID | 18782753 |
PI4KA | FLJ16556 | PI4K-ALPHA | PIK4CA | pi4K230 | phosphatidylinositol 4-kinase, catalytic, alpha | Two-hybrid | BioGRID | 16169070 |
PPP2CA | PP2Ac | PP2CA | RP-C | protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform | Affinity Capture-MS | BioGRID | 18782753 |
PPP2CB | PP2CB | protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform | Affinity Capture-MS | BioGRID | 18782753 |
PPP2R1A | MGC786 | PR65A | protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform | Affinity Capture-MS | BioGRID | 18782753 |
RP5-1000E10.4 | DKFZp686A0768 | FLJ21168 | SIKE | suppressor of IKK epsilon | Affinity Capture-MS | BioGRID | 18782753 |
RP6-213H19.1 | MASK | MST4 | serine/threonine protein kinase MST4 | Affinity Capture-MS | BioGRID | 18782753 |
SLC25A6 | AAC3 | ANT3 | ANT3Y | MGC17525 | solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 | Two-hybrid | BioGRID | 16169070 |
STK24 | MST-3 | MST3 | MST3B | STE20 | STK3 | serine/threonine kinase 24 (STE20 homolog, yeast) | Affinity Capture-MS | BioGRID | 17353931 |18782753 |
STK25 | DKFZp686J1430 | SOK1 | YSK1 | serine/threonine kinase 25 (STE20 homolog, yeast) | Affinity Capture-MS | BioGRID | 18782753 |
STRN | MGC125642 | SG2NA | striatin, calmodulin binding protein | Affinity Capture-MS | BioGRID | 18782753 |
STRN3 | SG2NA | striatin, calmodulin binding protein 3 | Affinity Capture-MS | BioGRID | 18782753 |
TRAF3IP3 | DJ434O14.3 | FLJ44151 | MGC117354 | MGC163289 | T3JAM | TRAF3 interacting protein 3 | Affinity Capture-MS | BioGRID | 18782753 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 8HR UP | 164 | 122 | All SZGR 2.0 genes in this pathway |
ZUCCHI METASTASIS DN | 44 | 29 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
AGUIRRE PANCREATIC CANCER COPY NUMBER UP | 298 | 174 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER POOR SURVIVAL A6 | 456 | 285 | All SZGR 2.0 genes in this pathway |
FIGUEROA AML METHYLATION CLUSTER 6 DN | 38 | 19 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-128 | 691 | 697 | m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-23 | 837 | 843 | 1A | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-29 | 130 | 137 | 1A,m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-377 | 694 | 700 | m8 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
miR-485-5p | 75 | 81 | m8 | hsa-miR-485-5p | AGAGGCUGGCCGUGAUGAAUUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.