SZGR2

Summary ?

GeneID	29888
Symbol	STRN4
Synonyms	ZIN\|zinedin
Description	striatin 4
Reference	MIM:614767\|HGNC:HGNC:15721\|Ensembl:ENSG00000090372\|HPRD:18125\|Vega:OTTHUMG00000183432
Gene type	protein-coding
Map location	19q13.2
Pascal p-value	0.212
Sherlock p-value	0.32
Fetal beta	0.006
DMG	1 (# studies)
eGene	Myers' cis & trans
Support	G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:vanEijk_2014	Genome-wide DNA methylation analysis	This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250).	3
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	3
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0631

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg12254611	19	47249193	STRN4;FKRP	3.448E-4	-0.233	0.041	DMG:Wockner_2014
cg06095560	19	47633912	STRN4	0.001	3.687		DMG:vanEijk_2014
cg11822964	19	47129337	STRN4	5.988E-4	-3.649		DMG:vanEijk_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs36781	chr5	109289728	STRN4	29888		0.14		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005516	calmodulin binding	TAS		10748158
GO:0005198	structural molecule activity	TAS		10748158
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007268	synaptic transmission	TAS	neuron, Synap, Neurotransmitter (GO term level: 6)	10748158
GO:0007165	signal transduction	TAS		10748158
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005624	membrane fraction	TAS		10748158
GO:0005737	cytoplasm	TAS		10748158
GO:0016020	membrane	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AK5	AK6 \| MGC33326	adenylate kinase 5	Two-hybrid	BioGRID	16169070
ASNS	TS11	asparagine synthetase	Two-hybrid	BioGRID	16169070
BAT1	D6S81E \| DDX39B \| UAP56	HLA-B associated transcript 1	Two-hybrid	BioGRID	16169070
CAV1	CAV \| MSTP085 \| VIP21	caveolin 1, caveolae protein, 22kDa	-	HPRD	11707266
CLDN12	-	claudin 12	Two-hybrid	BioGRID	16169070
CTTNBP2	C7orf8 \| CORTBP2 \| FLJ34229 \| KIAA1758 \| MGC104579 \| Orf4	cortactin binding protein 2	Affinity Capture-MS	BioGRID	18782753
CTTNBP2NL	DKFZp547A023 \| FLJ13278	CTTNBP2 N-terminal like	Affinity Capture-MS	BioGRID	18782753
ECSIT	SITPEC	ECSIT homolog (Drosophila)	Two-hybrid	BioGRID	16169070
FAM40A	FLJ14743 \| KIAA1761 \| MGC148091 \| RP4-773N10.1	family with sequence similarity 40, member A	Affinity Capture-MS	BioGRID	18782753
GDF9	-	growth differentiation factor 9	Two-hybrid	BioGRID	16169070
KLHDC2	HCLP-1 \| LCP	kelch domain containing 2	Two-hybrid	BioGRID	16169070
MCC	DKFZp762O1615 \| FLJ38893 \| FLJ46755 \| MCC1	mutated in colorectal cancers	Affinity Capture-MS	BioGRID	17353931
MOBKL3	2C4D \| CGI-95 \| MGC12264 \| MOB1 \| MOB3 \| PREI3	MOB1, Mps One Binder kinase activator-like 3 (yeast)	Affinity Capture-MS	BioGRID	18782753
MTG1	GTP \| GTPBP7 \| RP11-108K14.2	mitochondrial GTPase 1 homolog (S. cerevisiae)	Two-hybrid	BioGRID	16169070
NBEA	BCL8B \| LYST2	neurobeachin	Two-hybrid	BioGRID	16169070
PDCD10	CCM3 \| MGC1212 \| MGC24477 \| TFAR15	programmed cell death 10	Affinity Capture-MS	BioGRID	18782753
PI4KA	FLJ16556 \| PI4K-ALPHA \| PIK4CA \| pi4K230	phosphatidylinositol 4-kinase, catalytic, alpha	Two-hybrid	BioGRID	16169070
PPP2CA	PP2Ac \| PP2CA \| RP-C	protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform	Affinity Capture-MS	BioGRID	18782753
PPP2CB	PP2CB	protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform	Affinity Capture-MS	BioGRID	18782753
PPP2R1A	MGC786 \| PR65A	protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform	Affinity Capture-MS	BioGRID	18782753
RP5-1000E10.4	DKFZp686A0768 \| FLJ21168 \| SIKE	suppressor of IKK epsilon	Affinity Capture-MS	BioGRID	18782753
RP6-213H19.1	MASK \| MST4	serine/threonine protein kinase MST4	Affinity Capture-MS	BioGRID	18782753
SLC25A6	AAC3 \| ANT3 \| ANT3Y \| MGC17525	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6	Two-hybrid	BioGRID	16169070
STK24	MST-3 \| MST3 \| MST3B \| STE20 \| STK3	serine/threonine kinase 24 (STE20 homolog, yeast)	Affinity Capture-MS	BioGRID	17353931 \|18782753
STK25	DKFZp686J1430 \| SOK1 \| YSK1	serine/threonine kinase 25 (STE20 homolog, yeast)	Affinity Capture-MS	BioGRID	18782753
STRN	MGC125642 \| SG2NA	striatin, calmodulin binding protein	Affinity Capture-MS	BioGRID	18782753
STRN3	SG2NA	striatin, calmodulin binding protein 3	Affinity Capture-MS	BioGRID	18782753
TRAF3IP3	DJ434O14.3 \| FLJ44151 \| MGC117354 \| MGC163289 \| T3JAM	TRAF3 interacting protein 3	Affinity Capture-MS	BioGRID	18782753

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
GARY CD5 TARGETS UP	473	314	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 8HR UP	164	122	All SZGR 2.0 genes in this pathway
ZUCCHI METASTASIS DN	44	29	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS EARLY PROGENITOR	532	309	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER UP	298	174	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER POOR SURVIVAL A6	456	285	All SZGR 2.0 genes in this pathway
FIGUEROA AML METHYLATION CLUSTER 6 DN	38	19	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-128	691	697	m8	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	691	697	m8	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-23	837	843	1A	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	837	843	1A	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-29	130	137	1A,m8	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-377	694	700	m8	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-485-5p	75	81	m8	hsa-miR-485-5p	AGAGGCUGGCCGUGAUGAAUUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: STRN4