Gene Page: EFEMP2

Summary
GeneID  30008
Symbol  EFEMP2
Synonyms  FBLN4|MBP1|UPH1
Description  EGF-containing fibulin-like extracellular matrix protein 2
See related  HGNC:3219|MIM:604633|Ensembl:ENSG00000172638|HPRD:05221|
Locus tag  -
Gene type  protein-coding
Map location  11q13.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0625 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004888transmembrane receptor activityIEA-
GO:0005509calcium ion bindingIEA-
GO:0005515protein bindingIPI16189514 
GO:0005201extracellular matrix structural constituentTAS10601734 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007596blood coagulationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
GO:0005604basement membraneTAS10601734 
GO:0016020membraneIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
APEX2APE2 | APEXL2 | XTH2APEX nuclease (apurinic/apyrimidinic endonuclease) 2Two-hybridBioGRID16189514 
AQP1AQP-CHIP | CHIP28 | CO | MGC26324aquaporin 1 (Colton blood group)Two-hybridBioGRID16189514 
BAT3BAG-6 | BAG6 | D6S52E | G3HLA-B associated transcript 3Two-hybridBioGRID16189514 
CATSPER1CATSPER | MGC33335 | MGC33368cation channel, sperm associated 1Two-hybridBioGRID16189514 
CCND3-cyclin D3Two-hybridBioGRID16189514 
CCNKCPR4 | MGC9113cyclin KTwo-hybridBioGRID16189514 
COL8A1C3orf7 | MGC9568collagen, type VIII, alpha 1Two-hybridBioGRID16189514 
FAM107ADRR1 | FLJ30158 | FLJ45473 | TU3Afamily with sequence similarity 107, member ATwo-hybridBioGRID16189514 
FAM115AKIAA0738family with sequence similarity 115, member ATwo-hybridBioGRID16189514 
FAM124BFLJ22746family with sequence similarity 124BTwo-hybridBioGRID16189514 
GLRX3FLJ11864 | GLRX4 | GRX3 | GRX4 | PICOT | TXNL2 | TXNL3 | bA500G10.4glutaredoxin 3Two-hybridBioGRID16189514 
HHEXHEX | HMPH | HOX11L-PEN | PRH | PRHXhematopoietically expressed homeoboxTwo-hybridBioGRID16189514 
HOXA1BSAS | HOX1 | HOX1F | MGC45232homeobox A1Two-hybridBioGRID16189514 
IL16FLJ16806 | FLJ42735 | FLJ44234 | HsT19289 | IL-16 | LCF | prIL-16interleukin 16 (lymphocyte chemoattractant factor)Two-hybridBioGRID16189514 
LINGO1FLJ14594 | LERN1 | LRRN6A | MGC17422 | UNQ201leucine rich repeat and Ig domain containing 1Two-hybridBioGRID16189514 
LRDDDKFZp434D229 | MGC16925 | PIDDleucine-rich repeats and death domain containingTwo-hybridBioGRID16189514 
PLSCR1MMTRA1Bphospholipid scramblase 1Two-hybridBioGRID16189514 
PLSCR4TRA1phospholipid scramblase 4Two-hybridBioGRID16189514 
RHOXF2PEPP-2 | PEPP2 | THG1Rhox homeobox family, member 2Affinity Capture-Western
Two-hybrid
BioGRID16189514 
RHPN1KIAA1929 | ODF5 | RHOPHILIN | RHPNrhophilin, Rho GTPase binding protein 1Two-hybridBioGRID16189514 
RIBC2C22orf11RIB43A domain with coiled-coils 2Two-hybridBioGRID16189514 
SGTASGT | alphaSGT | hSGTsmall glutamine-rich tetratricopeptide repeat (TPR)-containing, alphaTwo-hybridBioGRID16189514 
SGTBFLJ39002 | SGT2small glutamine-rich tetratricopeptide repeat (TPR)-containing, betaTwo-hybridBioGRID16189514 
TP53FLJ92943 | LFS1 | TRP53 | p53tumor protein p53-HPRD,BioGRID10380882 
UBQLN1DA41 | DSK2 | FLJ90054 | PLIC-1 | XDRP1ubiquilin 1Two-hybridBioGRID16189514 
ZNF263FPM315 | ZKSCAN12zinc finger protein 263Two-hybridBioGRID16189514 
ZNF426MGC2663zinc finger protein 426Two-hybridBioGRID16189514 
ZNF638DKFZp686P1231 | MGC26130 | MGC90196 | NP220 | ZFML | Zfp638zinc finger protein 638Two-hybridBioGRID16189514 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-204/2117985m8hsa-miR-204brainUUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211UUCCCUUUGUCAUCCUUCGCCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.