Gene Page: NXPH1
Summary ?
| GeneID | 30010 |
| Symbol | NXPH1 |
| Synonyms | NPH1|Nbla00697 |
| Description | neurexophilin 1 |
| Reference | MIM:604639|HGNC:HGNC:20693|Ensembl:ENSG00000122584|HPRD:06867|Vega:OTTHUMG00000151941 |
| Gene type | protein-coding |
| Map location | 7p22 |
| Pascal p-value | 0.044 |
| Sherlock p-value | 0.913 |
| Fetal beta | -1.033 |
| DMG | 1 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg14094983 | 7 | 8482099 | NXPH1 | 1.257E-4 | -0.247 | 0.03 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005102 | receptor binding | IEA | Neurotransmitter (GO term level: 4) | - |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005576 | extracellular region | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
| ZHENG GLIOBLASTOMA PLASTICITY UP | 250 | 168 | All SZGR 2.0 genes in this pathway |
| YAUCH HEDGEHOG SIGNALING PARACRINE DN | 264 | 159 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-101 | 496 | 502 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
| miR-139 | 497 | 503 | m8 | hsa-miR-139brain | UCUACAGUGCACGUGUCU |
| miR-141/200a | 925 | 931 | 1A | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
| hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
| miR-144 | 496 | 502 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
| miR-15/16/195/424/497 | 107 | 113 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
| hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
| hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
| hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
| hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
| hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
| miR-186 | 550 | 557 | 1A,m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
| miR-200bc/429 | 546 | 552 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
| hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
| hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
| miR-203.1 | 274 | 281 | 1A,m8 | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
| miR-204/211 | 796 | 802 | 1A | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
| hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU | ||||
| miR-339 | 49 | 55 | m8 | hsa-miR-339 | UCCCUGUCCUCCAGGAGCUCA |
| miR-383 | 779 | 786 | 1A,m8 | hsa-miR-383brain | AGAUCAGAAGGUGAUUGUGGCU |
| miR-409-3p | 608 | 614 | 1A | hsa-miR-409-3p | CGAAUGUUGCUCGGUGAACCCCU |
| miR-452 | 672 | 678 | 1A | hsa-miR-452 | UGUUUGCAGAGGAAACUGAGAC |
| miR-485-3p | 890 | 897 | 1A,m8 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
| miR-493-5p | 1155 | 1161 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
| miR-496 | 818 | 824 | m8 | hsa-miR-496 | AUUACAUGGCCAAUCUC |
| miR-505 | 1084 | 1090 | 1A | hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.