Gene Page: SLC40A1

Summary
GeneID  30061
Symbol  SLC40A1
Synonyms  FPN1|HFE4|IREG1|MST079|MSTP079|MTP1|SLC11A3
Description  solute carrier family 40 (iron-regulated transporter), member 1
See related  HGNC:10909|MIM:604653|Ensembl:ENSG00000138449|HPRD:05229|
Locus tag  -
Gene type  protein-coding
Map location  2q32
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005506iron ion bindingIEA-
GO:0005381iron ion transmembrane transporter activityTAS10747949 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0009653anatomical structure morphogenesisTAS10693807 
GO:0006826iron ion transportTAS10693807 
GO:0006811ion transportIEA-
GO:0006879cellular iron ion homeostasisTAS10747949 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0008021synaptic vesicleIEASynap, Neurotransmitter (GO term level: 12)-
GO:0005737cytoplasmTAS10747949 
GO:0005886plasma membraneIEA-
GO:0005887integral to plasma membraneTAS10693807 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
HAMPHEPC | HEPCIDIN | HFE2B | LEAP-1 | LEAP1 | PLTRhepcidin antimicrobial peptideHepcidin interacts with ferroportin.BIND15514116 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-17-5p/20/93.mr/106/519.d11321138m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.