Gene Page: SOX8

Summary
GeneID  30812
Symbol  SOX8
Synonyms  MGC24837
Description  SRY (sex determining region Y)-box 8
See related  HGNC:11203|MIM:605923|Ensembl:ENSG00000005513|HPRD:16175|
Locus tag  -
Gene type  protein-coding
Map location  16p13.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
GO:0003700transcription factor activityNAS10684944 
GO:0003702RNA polymerase II transcription factor activityTAS10684944 
GO:0005515protein bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007417central nervous system developmentTASBrain (GO term level: 6)10662550 
GO:0001701in utero embryonic developmentIEA-
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionIEA-
GO:0048469cell maturationIEA-
GO:0007422peripheral nervous system developmentIEA-
GO:0045165cell fate commitmentIEA-
GO:0045944positive regulation of transcription from RNA polymerase II promoterIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
NR5A1AD4BP | ELP | FTZ1 | FTZF1 | SF-1 | SF1nuclear receptor subfamily 5, group A, member 1-HPRD12732652 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/50613021308m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.