Gene Page: HNRNPL

Summary
GeneID  3191
Symbol  HNRNPL
Synonyms  FLJ35509|HNRPL|P/OKcl.14|hnRNP-L
Description  heterogeneous nuclear ribonucleoprotein L
See related  HGNC:5045|MIM:603083|Ensembl:ENSG00000104824|HPRD:04360|
Locus tag  -
Gene type  protein-coding
Map location  19q13.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 2.305 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003723RNA bindingTAS2687284 
GO:0005515protein bindingIPI17353931 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0000398nuclear mRNA splicing, via spliceosomeEXP12226669 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005654nucleoplasmTAS2687284 
GO:0030530heterogeneous nuclear ribonucleoprotein complexTAS2687284 
GO:0045120pronucleusIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
APEX1APE | APE-1 | APE1 | APEN | APEX | APX | HAP1 | REF-1 | REF1APEX nuclease (multifunctional DNA repair enzyme) 1-HPRD,BioGRID11809897 
CSE1LCAS | CSE1 | MGC117283 | MGC130036 | MGC130037 | XPO2CSE1 chromosome segregation 1-like (yeast)Two-hybridBioGRID16169070 
DOCK4FLJ34238 | KIAA0716 | MGC134911 | MGC134912dedicator of cytokinesis 4Affinity Capture-MSBioGRID17353931 
EIF2B1EIF-2B | EIF-2Balpha | EIF2B | EIF2BA | MGC117409 | MGC125868 | MGC125869eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDaAffinity Capture-MSBioGRID17353931 
FGFR3ACH | CD333 | CEK2 | HSFGFR3EX | JTK4fibroblast growth factor receptor 3Two-hybridBioGRID16169070 
GSTZ1GSTZ1-1 | MAAI | MAI | MGC2029glutathione transferase zeta 1hnRNP L interacts with GSTZ1 RNA.BIND15889141 
HMG20BBRAF25 | BRAF35 | FLJ26127 | HMGX2 | PP7706 | SMARCE1r | SOXL | pp8857high-mobility group 20BTwo-hybridBioGRID16169070 
HNRNPA2B1DKFZp779B0244 | FLJ22720 | HNRNPA2 | HNRNPB1 | HNRPA2 | HNRPA2B1 | HNRPB1 | RNPA2 | SNRPB1heterogeneous nuclear ribonucleoprotein A2/B1-HPRD,BioGRID10441480 
HNRNPKCSBP | FLJ41122 | HNRPK | TUNPheterogeneous nuclear ribonucleoprotein KhnRNP L interacts with hnRNP K. This interaction was modeled on a demonstrated interaction between hnRNP K from an unspecified source and human hnRNP L.BIND10809782 
-HPRD,BioGRID10772858 
HNRNPLFLJ35509 | HNRPL | P/OKcl.14 | hnRNP-Lheterogeneous nuclear ribonucleoprotein L-HPRD,BioGRID10772858 
PCBP2HNRPE2 | MGC110998 | hnRNP-E2poly(rC) binding protein 2-HPRD,BioGRID10772858 
PTBP1HNRNP-I | HNRNPI | HNRPI | MGC10830 | MGC8461 | PTB | PTB-1 | PTB-T | PTB2 | PTB3 | PTB4 | pPTBpolypyrimidine tract binding protein 1PTB interacts with hnRNP L.BIND9563502 
-HPRD,BioGRID9563502 |10772858 
PUF60FIR | FLJ31379 | RoBPI | SIAHBP1poly-U binding splicing factor 60KDaAffinity Capture-MSBioGRID17353931 
SLC2A2GLUT2solute carrier family 2 (facilitated glucose transporter), member 2hnRNP L interacts with SLC2A2 RNA.BIND15889141 
YWHAZKCIP-1 | MGC111427 | MGC126532 | MGC138156tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptideAffinity Capture-MSBioGRID17353931 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-203.12983051A,m8hsa-miR-203UGAAAUGUUUAGGACCACUAG
miR-37028341Ahsa-miR-370brainGCCUGCUGGGGUGGAACCUGG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.