Gene Page: HSF2

Summary
GeneID  3298
Symbol  HSF2
Synonyms  MGC117376|MGC156196|MGC75048
Description  heat shock transcription factor 2
See related  HGNC:5225|MIM:140581|Ensembl:ENSG00000025156|HPRD:00779|
Locus tag  -
Gene type  protein-coding
Map location  6q22.31
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003700transcription factor activityTAS1871106 
GO:0003713transcription coactivator activityTAS1871106 
GO:0043565sequence-specific DNA bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionIEA-
GO:0006366transcription from RNA polymerase II promoterTAS1871106 
GO:0006950response to stressIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005737cytoplasmIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
HSF1HSTF1heat shock transcription factor 1-HPRD,BioGRID12813038 
HSF2BP-heat shock transcription factor 2 binding protein-HPRD9651507 
HSPA1AFLJ54303 | FLJ54370 | FLJ54392 | FLJ54408 | FLJ75127 | HSP70-1 | HSP70-1A | HSP70I | HSP72 | HSPA1 | HSPA1Bheat shock 70kDa protein 1AHSF2 interacts with hsp70i promoter.BIND15662014 
NCAPGCAPG | CHCG | FLJ12450 | HCAP-G | MGC126525 | NY-MEL-3non-SMC condensin I complex, subunit GHSF2 interacts with CAP-G.BIND15662014 
NUP62DKFZp547L134 | FLJ20822 | FLJ43869 | IBSN | MGC841 | SNDI | p62nucleoporin 62kDa-HPRD,BioGRID9367915 
PPP2R1AMGC786 | PR65Aprotein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform-HPRD10224043 
UBE2IC358B7.1 | P18 | UBC9ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)Two-hybridBioGRID11278381 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-144111117m8hsa-miR-144UACAGUAUAGAUGAUGUACUAG
miR-18127133m8hsa-miR-18aUAAGGUGCAUCUAGUGCAGAUA
hsa-miR-18bUAAGGUGCAUCUAGUGCAGUUA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.