Gene Page: HSPA4

Summary
GeneID  3308
Symbol  HSPA4
Synonyms  APG-2|HS24/P52|MGC131852|RY|hsp70|hsp70RY
Description  heat shock 70kDa protein 4
See related  HGNC:5237|MIM:601113|Ensembl:ENSG00000170606|HPRD:09025|
Locus tag  -
Gene type  protein-coding
Map location  5q31.1-q31.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0032 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0005524ATP bindingIEA-
GO:0005524ATP bindingNAS8335910 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006950response to stressIEA-
GO:0006986response to unfolded proteinNAS8335910 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmNAS-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
APAF1CED4 | DKFZp781B1145apoptotic peptidase activating factor 1Affinity Capture-Western
Co-purification
Reconstituted Complex		BioGRID10934467 
BAG1RAP46BCL2-associated athanogeneBAG1 interacts with Hsp70.BIND15603737 
BAG4BAG-4 | SODDBCL2-associated athanogene 4Affinity Capture-WesternBioGRID14559896 
BAG5BAG-5BCL2-associated athanogene 5BAG5 interacts with Hsp70.BIND15603737 
CDC73C1orf28 | FLJ23316 | HPT-JT | HRPT2cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)Two-hybridBioGRID16169070 
CHTF18C16orf41 | C321D2.2 | C321D2.3 | C321D2.4 | CHL12 | Ctf18 | RUVBLCTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)Affinity Capture-MSBioGRID12930902 
DNAJB1HSPF1 | Hdj1 | Hsp40 | Sis1DnaJ (Hsp40) homolog, subfamily B, member 1Affinity Capture-Western
Reconstituted Complex		BioGRID14503850 
DNAJB11ABBP-2 | ABBP2 | DJ9 | EDJ | ERdj3 | ERj3 | HEDJ | PRO1080 | UNQ537 | hDj9DnaJ (Hsp40) homolog, subfamily B, member 11Affinity Capture-WesternBioGRID11584023 
DNAJC3HP58 | P58 | P58IPK | PRKRIDnaJ (Hsp40) homolog, subfamily C, member 3Affinity Capture-WesternBioGRID11116152 
DNMBPKIAA1010 | TUBAdynamin binding proteinAffinity Capture-MSBioGRID14506234 
ESR1DKFZp686N23123 | ER | ESR | ESRA | Era | NR3A1estrogen receptor 1Reconstituted ComplexBioGRID9222609 
FESFPSfeline sarcoma oncogeneReconstituted ComplexBioGRID9222609 
GRPEL2DKFZp451C205 | FLJ23713 | FLJ33918 | Mt-GrpE#2GrpE-like 2, mitochondrial (E. coli)-HPRD9694873 
HCFC1CFF | HCF-1 | HCF1 | HFC1 | MGC70925 | VCAFhost cell factor C1 (VP16-accessory protein)Affinity Capture-MSBioGRID12670868 
HDAC1DKFZp686H12203 | GON-10 | HD1 | RPD3 | RPD3L1histone deacetylase 1Affinity Capture-WesternBioGRID11777905 
HDAC2RPD3 | YAF1histone deacetylase 2Affinity Capture-WesternBioGRID11777905 
HDAC3HD3 | RPD3 | RPD3-2histone deacetylase 3-HPRD,BioGRID11777905 
HSBP1DKFZp686D1664 | DKFZp686O24200 | NPC-A-13heat shock factor binding protein 1in vitro
in vivo		BioGRID9649501 
HSF1HSTF1heat shock transcription factor 1Reconstituted ComplexBioGRID1628823 |9222609 
HSPBP1-hsp70-interacting proteinAffinity Capture-Western
Reconstituted Complex		BioGRID14503850 
HTTHD | IT15huntingtinHtt interacts with HSP70.BIND15654337 
IRS4IRS-4 | PY160insulin receptor substrate 4Affinity Capture-MSBioGRID11912194 
KPNA2IPOA1 | QIP2 | RCH1 | SRP1alphakaryopherin alpha 2 (RAG cohort 1, importin alpha 1)Hsp70 interacts with karyopherin alpha (K-alpha).BIND10964507 
KRT18CYK18 | K18keratin 18Reconstituted ComplexBioGRID7529764 
MAP3K3MAPKKK3 | MEKK3mitogen-activated protein kinase kinase kinase 3-HPRD,BioGRID14743216 
MAP3K7IP13'-Tab1 | MGC57664 | TAB1mitogen-activated protein kinase kinase kinase 7 interacting protein 1-HPRD14743216 
MARK4FLJ90097 | KIAA1860 | MARKL1 | Nbla00650MAP/microtubule affinity-regulating kinase 4Affinity Capture-MSBioGRID14594945 
NCOR1KIAA1047 | MGC104216 | N-CoR | TRAC1 | hCIT529I10 | hN-CoRnuclear receptor co-repressor 1Affinity Capture-MSBioGRID14527417 
NQO1DHQU | DIA4 | DTD | NMOR1 | NMORI | QR1NAD(P)H dehydrogenase, quinone 1Affinity Capture-WesternBioGRID11821413 
NR3C2MCR | MGC133092 | MLR | MRnuclear receptor subfamily 3, group C, member 2-HPRD9392437 
PRSS23MGC5107 | SIG13 | SPUVE | ZSIG13protease, serine, 23Two-hybridBioGRID16169070 
PTGES3P23 | TEBP | cPGESprostaglandin E synthase 3 (cytosolic)in vivoBioGRID12077419 
SELSAD-015 | ADO15 | MGC104346 | MGC2553 | SBBI8 | SEPS1 | VIMPselenoprotein SAffinity Capture-WesternBioGRID15215856 
SGTASGT | alphaSGT | hSGTsmall glutamine-rich tetratricopeptide repeat (TPR)-containing, alphaFar WesternBioGRID12482202 
STIP1HOP | IEF-SSP-3521 | P60 | STI1 | STI1Lstress-induced-phosphoprotein 1Affinity Capture-WesternBioGRID9452498 
STUB1CHIP | HSPABP2 | NY-CO-7 | SDCCAG7 | UBOX1STIP1 homology and U-box containing protein 1in vitro
in vivo
Two-hybrid		BioGRID10330192 
TCERG1CA150 | MGC133200 | TAF2Stranscription elongation regulator 1Affinity Capture-MSBioGRID15456888 
TIMM44DKFZp686H05241 | TIM44translocase of inner mitochondrial membrane 44 homolog (yeast)Reconstituted ComplexBioGRID12677068 
TRAF2MGC:45012 | TRAP | TRAP3TNF receptor-associated factor 2-HPRD14743216 
TTC1FLJ46404 | TPR1tetratricopeptide repeat domain 1Affinity Capture-Western
Reconstituted Complex		BioGRID14503850 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-32038441Ahsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-369-3p30361Ahsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-37430371A,m8hsa-miR-374UUAUAAUACAACCUGAUAAGUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.