Gene Page: KY

Summary
GeneID  339855
Symbol  KY
Synonyms  FLJ33207
Description  kyphoscoliosis peptidase
See related  HGNC:26576|MIM:605739|Ensembl:ENSG00000174611|HPRD:13953|
Locus tag  -
Gene type  protein-coding
Map location  3q22.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 2.536 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0008233peptidase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007528neuromuscular junction developmentIEASynap (GO term level: 10)-
GO:0007517muscle developmentIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005856cytoskeletonIEA-
GO:0005737cytoplasmIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
FLNCABP-280 | ABP280A | ABPA | ABPL | FLJ10186 | FLN2filamin C, gamma (actin binding protein 280)KY interacts with FLNC. This interaction was modeled on a demonstrated interaction between mouse KY and human FLNC.BIND15385448 
IGFN1DKFZp434B1231 | EEF1A2BP1immunoglobulin-like and fibronectin type III domain containing 1KY interacts with DKFZp434B1231 (KYIP). This interaction was modeled on a demonstrated interaction between mouse KY and human KYIP.BIND15385448 
MYBPC1MYBPCC | MYBPCS | slow-typemyosin binding protein C, slow typeKY interacts with an unspecified isoform of MYBPC1. This interaction was modeled on a demonstrated interaction between mouse KY and human MYBPC1.BIND15385448 
TTNCMD1G | CMH9 | CMPD4 | CONNECTIN | DKFZp451N061 | EOMFC | FLJ26020 | FLJ26409 | FLJ32040 | FLJ34413 | FLJ39564 | FLJ43066 | HMERF | LGMD2J | TMDtitinKY interacts with an unspecified isoform of TTN. This interaction was modeled on a demonstrated interaction between mouse KY and human TTN.BIND15385448 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-292342401Ahsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-376c2382441Ahsa-miR-376cAACAUAGAGGAAAUUCCACG
miR-4962402461Ahsa-miR-496AUUACAUGGCCAAUCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.