SZGR2

Summary ?

GeneID	345557
Symbol	PLCXD3
Synonyms	-
Description	phosphatidylinositol specific phospholipase C X domain containing 3
Reference	HGNC:HGNC:31822\|Ensembl:ENSG00000182836\|HPRD:17860\|Vega:OTTHUMG00000162076
Gene type	protein-coding
Map location	5p13.1
Pascal p-value	0.141
Fetal beta	-1.424
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
Expression	Meta-analysis of gene expression	P value: 1.627

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg17985972	5	41334593	PLCXD3	9.01E-5	-0.569	0.027	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
LU TUMOR VASCULATURE DN	13	6	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY DN	367	220	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP	544	308	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
LIN NPAS4 TARGETS UP	163	100	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF ICP WITH H3K27ME3	206	108	All SZGR 2.0 genes in this pathway
MIKKELSEN IPS ICP WITH H3K4ME3 AND H327ME3	126	83	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	6296	6302	m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-124.1	4562	4568	1A	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124.1	4562	4568	1A	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	2835	2841	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
				hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-136	2929	2936	1A,m8	hsa-miR-136	ACUCCAUUUGUUUUGAUGAUGGA
miR-141/200a	222	228	1A	hsa-miR-141	UAACACUGUCUGGUAAAGAUGG
miR-141/200a	222	228	1A	hsa-miR-200a	UAACACUGUCUGGUAACGAUGU
miR-183	4265	4271	1A	hsa-miR-183	UAUGGCACUGGUAGAAUUCACUG
miR-218	1530	1536	1A	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-22	644	651	1A,m8	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-23	6570	6577	1A,m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	6570	6577	1A,m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-30-5p	296	302	m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-323	6570	6576	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-455	4547	4553	m8	hsa-miR-455	UAUGUGCCUUUGGACUACAUCG
miR-485-3p	4457	4463	m8	hsa-miR-485-3p	GUCAUACACGGCUCUCCUCUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PLCXD3