Gene Page: TUBB2B

Summary
GeneID  347733
Symbol  TUBB2B
Synonyms  DKFZp566F223|FLJ98847|MGC8685|TUBB-PARALOG|bA506K6.1
Description  tubulin, beta 2B
See related  HGNC:30829|Ensembl:ENSG00000137285|HPRD:14707|
Locus tag  RP11-506K6.1
Gene type  protein-coding
Map location  6p25
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0159 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003924GTPase activityIEA-
GO:0005525GTP bindingIEA-
GO:0005198structural molecule activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007018microtubule-based movementIEA-
GO:0051258protein polymerizationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005874microtubuleIEA-
GO:0005737cytoplasmIEA-
GO:0043234protein complexIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
IKBKBFLJ40509 | IKK-beta | IKK2 | IKKB | MGC131801 | NFKBIKBinhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta-HPRD14743216 
MAP3K14FTDCR1B | HS | HSNIK | NIKmitogen-activated protein kinase kinase kinase 14-HPRD14743216 
MAP3K3MAPKKK3 | MEKK3mitogen-activated protein kinase kinase kinase 3-HPRD14743216 
MAP3K7TAK1 | TGF1amitogen-activated protein kinase kinase kinase 7-HPRD14743216 
MAP3K7IP13'-Tab1 | MGC57664 | TAB1mitogen-activated protein kinase kinase kinase 7 interacting protein 1-HPRD14743216 
MDKFLJ27379 | MK | NEGF2midkine (neurite growth-promoting factor 2)Affinity Capture-MSBioGRID10772929 
NFKB1DKFZp686C01211 | EBP-1 | KBF1 | MGC54151 | NF-kappa-B | NFKB-p105 | NFKB-p50 | p105nuclear factor of kappa light polypeptide gene enhancer in B-cells 1-HPRD14743216 
NFKB2LYT-10 | LYT10nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)-HPRD14743216 
RELAMGC131774 | NFKB3 | p65v-rel reticuloendotheliosis viral oncogene homolog A (avian)-HPRD14743216 
RIPK2CARD3 | CARDIAK | CCK | GIG30 | RICK | RIP2receptor-interacting serine-threonine kinase 2-HPRD14743216 
RIPK3RIP3receptor-interacting serine-threonine kinase 3-HPRD14743216 
TNFRSF1ACD120a | FPF | MGC19588 | TBP1 | TNF-R | TNF-R-I | TNF-R55 | TNFAR | TNFR1 | TNFR55 | TNFR60 | p55 | p55-R | p60tumor necrosis factor receptor superfamily, member 1A-HPRD14743216 
TNFRSF1BCD120b | TBPII | TNF-R-II | TNF-R75 | TNFBR | TNFR1B | TNFR2 | TNFR80 | p75 | p75TNFRtumor necrosis factor receptor superfamily, member 1B-HPRD14743216 
TRAF6MGC:3310 | RNF85TNF receptor-associated factor 6-HPRD14743216 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-29126132m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.