Gene Page: IGFBP5

Summary
GeneID  3488
Symbol  IGFBP5
Synonyms  IBP5
Description  insulin-like growth factor binding protein 5
See related  HGNC:5474|MIM:146734|Ensembl:ENSG00000115461|HPRD:00901|
Locus tag  -
Gene type  protein-coding
Map location  2q33-q36
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01016 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00916 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0031994insulin-like growth factor I bindingIPI10766744 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001558regulation of cell growthIEA-
GO:0007165signal transductionNAS7525452 
GO:0014912negative regulation of smooth muscle cell migrationIDA10766744 
GO:0043569negative regulation of insulin-like growth factor receptor signaling pathwayIDA10766744 
GO:0048662negative regulation of smooth muscle cell proliferationIDA10766744 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionNAS14718574 
GO:0005783endoplasmic reticulumIEA-
GO:0016942insulin-like growth factor binding protein complexIC10766744 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ADAM12MCMP | MCMPMltna | MLTN | MLTNAADAM metallopeptidase domain 12-HPRD,BioGRID11095942 
BAT3BAG-6 | BAG6 | D6S52E | G3HLA-B associated transcript 3Two-hybridBioGRID16169070 
FHL2AAG11 | DRAL | SLIM3four and a half LIM domains 2-HPRD,BioGRID11821401 
IGF1IGFIinsulin-like growth factor 1 (somatomedin C)IGF-I interacts with IGFBP-5.BIND10407151 
-HPRD,BioGRID9497324 
IGF2C11orf43 | FLJ22066 | FLJ44734 | INSIGF | pp9974insulin-like growth factor 2 (somatomedin A)IGF-II interacts with IGFBP-5.BIND10407151 
-HPRD,BioGRID9497324 
IGFALSALSinsulin-like growth factor binding protein, acid labile subunit-HPRD,BioGRID9497324 |9786878 
SERPINE1PAI | PAI-1 | PAI1 | PLANH1serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1in vitro
in vivo
BioGRID9202242 
SPP1BNSP | BSPI | ETA-1 | MGC110940 | OPNsecreted phosphoprotein 1-HPRD,BioGRID10698186 
TFDKFZp781D0156 | PRO1557 | PRO2086transferrin-HPRD11297622 
THBS1THBS | TSP | TSP1thrombospondin 1Reconstituted ComplexBioGRID10698186 
IGFBP-5 interacts with TS-1.BIND15700281 
VTNV75 | VN | VNTvitronectin-HPRD,BioGRID11751588 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1/2066636691Ahsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
miR-10138213827m8hsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-13639373943m8hsa-miR-136ACUCCAUUUGUUUUGAUGAUGGA
miR-137424042461Ahsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-14038393845m8hsa-miR-140brainAGUGGUUUUACCCUAUGGUAG
miR-14391981A,m8hsa-miR-143brainUGAGAUGAAGCACUGUAGCUCA
miR-14926112617m8hsa-miR-149brainUCUGGCUCCGUGUCUUCACUCC
miR-193248524921A,m8hsa-miR-193aAACUGGCCUACAAAGUCCCAG
hsa-miR-193bAACUGGCCCUCAAAGUCCCGCUUU
miR-203.187931Ahsa-miR-203UGAAAUGUUUAGGACCACUAG
miR-24260926161A,m8hsa-miR-24SZUGGCUCAGUUCAGCAGGAACAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.