Gene Page: HCN1
Summary ?
| GeneID | 348980 |
| Symbol | HCN1 |
| Synonyms | BCNG-1|BCNG1|EIEE24|HAC-2 |
| Description | hyperpolarization activated cyclic nucleotide gated potassium channel 1 |
| Reference | MIM:602780|HGNC:HGNC:4845|Ensembl:ENSG00000164588|HPRD:09099|Vega:OTTHUMG00000131155 |
| Gene type | protein-coding |
| Map location | 5p12 |
| Pascal p-value | 5.11E-7 |
| Fetal beta | -0.982 |
| DMG | 1 (# studies) |
| Support | LIGAND GATED ION SIGNALING |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
| CV:PGC128 | Genome-wide Association Study | A multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
CV:PGC128
| SNP ID | Chromosome | Position | Allele | P | Function | Gene | Up/Down Distance |
|---|---|---|---|---|---|---|---|
| rs1501357 | chr5 | 45364875 | TC | 1.236E-8 | intronic | HCN1 |
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg05964600 | 5 | 45288543 | HCN1 | 5.297E-4 | -0.493 | 0.048 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0005244 | voltage-gated ion channel activity | IEA | - | |
| GO:0005249 | voltage-gated potassium channel activity | IEA | - | |
| GO:0005272 | sodium channel activity | IEA | - | |
| GO:0030552 | cAMP binding | IEA | - | |
| GO:0030955 | potassium ion binding | IEA | - | |
| GO:0031402 | sodium ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006814 | sodium ion transport | IEA | - | |
| GO:0006811 | ion transport | IEA | - | |
| GO:0006813 | potassium ion transport | NAS | 9405696 | |
| GO:0045176 | apical protein localization | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0030425 | dendrite | IEA | neuron, axon, dendrite (GO term level: 6) | - |
| GO:0030424 | axon | IEA | neuron, axon, Neurotransmitter (GO term level: 6) | - |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | NAS | 9405696 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME NEURONAL SYSTEM | 279 | 221 | All SZGR 2.0 genes in this pathway |
| REACTOME POTASSIUM CHANNELS | 98 | 68 | All SZGR 2.0 genes in this pathway |
| XU GH1 AUTOCRINE TARGETS UP | 268 | 157 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
| PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 DN | 157 | 106 | All SZGR 2.0 genes in this pathway |
| SERVITJA ISLET HNF1A TARGETS UP | 163 | 111 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-10 | 2333 | 2340 | 1A,m8 | hsa-miR-10a | UACCCUGUAGAUCCGAAUUUGUG |
| hsa-miR-10b | UACCCUGUAGAACCGAAUUUGU | ||||
| miR-135 | 2612 | 2619 | 1A,m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
| hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
| miR-141/200a | 218 | 225 | 1A,m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
| hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
| miR-224 | 1145 | 1151 | 1A | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
| miR-381 | 939 | 945 | m8 | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
| miR-410 | 2174 | 2180 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
| miR-431 | 2027 | 2033 | m8 | hsa-miR-431 | UGUCUUGCAGGCCGUCAUGCA |
| miR-485-3p | 2567 | 2573 | m8 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
| miR-496 | 140 | 146 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
| miR-543 | 700 | 706 | 1A | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
| miR-544 | 19 | 25 | 1A | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
| miR-7 | 229 | 235 | m8 | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.