Gene Page: ACTR3B

Summary
GeneID  57180
Symbol  ACTR3B
Synonyms  ARP11|ARP3BETA|DKFZp686O24114
Description  ARP3 actin-related protein 3 homolog B (yeast)
See related  HGNC:17256|Ensembl:ENSG00000133627|HPRD:12489|
Locus tag  -
Gene type  protein-coding
Map location  7q36.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003779actin bindingIEA-
GO:0005515protein bindingIEA-
GO:0005515protein bindingIPI17353931 
GO:0005524ATP bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0030833regulation of actin filament polymerizationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0042995cell projectionIEAaxon (GO term level: 4)-
GO:0005856cytoskeletonIEA-
GO:0005737cytoplasmIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACTR2ARP2ARP2 actin-related protein 2 homolog (yeast)Affinity Capture-MSBioGRID17353931 
ARPC1AArc40 | SOP2Hs | SOP2Lactin related protein 2/3 complex, subunit 1A, 41kDaAffinity Capture-MSBioGRID17353931 
ARPC1BARC41 | p40-ARC | p41-ARCactin related protein 2/3 complex, subunit 1B, 41kDaAffinity Capture-MSBioGRID17353931 
ARPC2ARC34 | PNAS-139 | PRO2446 | p34-Arcactin related protein 2/3 complex, subunit 2, 34kDaAffinity Capture-MSBioGRID17353931 
ARPC3ARC21 | p21-Arcactin related protein 2/3 complex, subunit 3, 21kDaAffinity Capture-MSBioGRID17353931 
ARPC3BdJ470L14.3actin related protein 2/3 complex, subunit 3B, 21kDaAffinity Capture-MSBioGRID17353931 
ARPC4ARC20 | MGC13544 | p20-Arcactin related protein 2/3 complex, subunit 4, 20kDaAffinity Capture-MSBioGRID17353931 
ARPC5ARC16 | MGC88523 | dJ127C7.3 | p16-Arcactin related protein 2/3 complex, subunit 5, 16kDaAffinity Capture-MSBioGRID17353931 
ARPC5LARC16-2 | MGC3038actin related protein 2/3 complex, subunit 5-likeAffinity Capture-MSBioGRID17353931 
CDK4CMM3 | MGC14458 | PSK-J3cyclin-dependent kinase 4Affinity Capture-MSBioGRID17353931 
KIAA1967DBC-1 | DBC1KIAA1967Affinity Capture-MSBioGRID17353931 
TWF2A6RP | A6r | MSTP011 | PTK9Ltwinfilin, actin-binding protein, homolog 2 (Drosophila)Affinity Capture-MSBioGRID17353931 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-264164221Ahsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
miR-4215455511Ahsa-miR-421GGCCUCAUUAAAUGUUUGUUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.