Gene Page: SUMO4

Summary
GeneID  387082
Symbol  SUMO4
Synonyms  IDDM5|SMT3H4|SUMO-4|dJ281H8.4
Description  SMT3 suppressor of mif two 3 homolog 4 (S. cerevisiae)
See related  HGNC:21181|MIM:608829|Ensembl:ENSG00000177688|HPRD:10584|
Locus tag  -
Gene type  protein-coding
Map location  6q25
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006464protein modification processIEA-
GO:0006511ubiquitin-dependent protein catabolic processIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
NFKBIAIKBA | MAD-3 | NFKBInuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha-HPRD,BioGRID15247916 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-204/211181A,m8hsa-miR-204brainUUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211UUCCCUUUGUCAUCCUUCGCCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.