Gene Page: FLJ41603

Summary
GeneID  389337
Symbol  FLJ41603
Synonyms  -
Description  FLJ41603 protein
See related  Ensembl:ENSG00000183111|HPRD:13454|
Locus tag  -
Gene type  protein-coding
Map location  5q33.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0032 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01718 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00459 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005089Rho guanyl-nucleotide exchange factor activityIEA-
GO:0005085guanyl-nucleotide exchange factor activityIEA-
GO:0005515protein bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0035023regulation of Rho protein signal transductionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005737cytoplasmIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/50624482454m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-342709715m8hsa-miR-342brainUCUCACACAGAAAUCGCACCCGUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.