Gene Page: LCP2

Summary
GeneID  3937
Symbol  LCP2
Synonyms  SLP-76|SLP76
Description  lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)
See related  HGNC:6529|MIM:601603|HPRD:03362|
Locus tag  -
Gene type  protein-coding
Map location  5q33.1-qter
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.0276 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI12029088 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007169transmembrane receptor protein tyrosine kinase signaling pathwayTAS7706237 
GO:0006955immune responseTAS7706237 
GO:0045576mast cell activationIEA-
GO:0050663cytokine secretionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005829cytosolEXP11048639 |11607830 |17652306 
GO:0005737cytoplasmIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CBLC-CBL | CBL2 | RNF55Cas-Br-M (murine) ecotropic retroviral transforming sequence-HPRD,BioGRID10204582 
CLNKMGC35197 | MISTcytokine-dependent hematopoietic cell linker-HPRD10562326 
FYBADAP | PRO0823 | SLAP-130FYN binding protein (FYB-120/130)-HPRD10497204 
-HPRD9115214 |9207119 
|10497204 
GRAP2GADS | GRAP-2 | GRB2L | GRBLG | GRID | GRPL | GrbX | Grf40 | Mona | P38GRB2-related adaptor protein 2-HPRD,BioGRID10021361 |10224278 
SLP-76 interacts with Gads.BIND10021361 
GRB2ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084growth factor receptor-bound protein 2Affinity Capture-Western
Reconstituted Complex
BioGRID8695800 |8995445 
|10204582 |10224278 
|11314042 
ITKEMT | LYK | MGC126257 | MGC126258 | PSCTK2IL2-inducible T-cell kinase-HPRD,BioGRID10636929 
LATLAT1 | pp36linker for activation of T cells-HPRD9489702 
LYNFLJ26625 | JTK8v-yes-1 Yamaguchi sarcoma viral related oncogene homolog-HPRD,BioGRID10026222 
MAP4K1HPK1mitogen-activated protein kinase kinase kinase kinase 1-HPRD11487585 
NCK1MGC12668 | NCK | NCKalphaNCK adaptor protein 1Nck interacts with SLP-76.BIND15558067 
-HPRD,BioGRID10229072 
PAG1CBP | FLJ37858 | MGC138364 | PAGphosphoprotein associated with glycosphingolipid microdomains 1-HPRD,BioGRID10790433 
PIK3R1GRB1 | p85 | p85-ALPHAphosphoinositide-3-kinase, regulatory subunit 1 (alpha)Affinity Capture-Western
Two-hybrid
BioGRID15388330 
PLCG1PLC-II | PLC1 | PLC148 | PLCgamma1phospholipase C, gamma 1-HPRD,BioGRID11390650 
PLCG2-phospholipase C, gamma 2 (phosphatidylinositol-specific)-HPRD,BioGRID10469124 
PRAM1MGC39864 | PRAM-1PML-RARA regulated adaptor molecule 1-HPRD,BioGRID11301322 
PTPN6HCP | HCPH | HPTP1C | PTP-1C | SH-PTP1 | SHP-1 | SHP-1L | SHP1protein tyrosine phosphatase, non-receptor type 6-HPRD,BioGRID8760799 |9765283 
PTPRCB220 | CD45 | CD45R | GP180 | LCA | LY5 | T200protein tyrosine phosphatase, receptor type, C-HPRD,BioGRID8703037 
SHBRP11-3J10.8 | bA3J10.2Src homology 2 domain containing adaptor protein B-HPRD,BioGRID12084069 
SYKDKFZp313N1010 | FLJ25043 | FLJ37489spleen tyrosine kinase-HPRD15388330 
TRAT1HSPC062 | TCRIM | TRIMT cell receptor associated transmembrane adaptor 1Reconstituted ComplexBioGRID10790433 
VAV1VAVvav 1 guanine nucleotide exchange factor-HPRD,BioGRID9047237 |9341187 
|11331248 
WASIMD2 | THC | WASPWiskott-Aldrich syndrome (eczema-thrombocytopenia)-HPRD,BioGRID10747096 
ZAP70FLJ17670 | FLJ17679 | SRK | STD | TZK | ZAP-70zeta-chain (TCR) associated protein kinase 70kDaBiochemical ActivityBioGRID9047237 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-30-3p343349m8hsa-miR-30a-3pCUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3pCUUUCAGUCGGAUGUUUACAGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.