Gene Page: ANKHD1-EIF4EBP3

Summary
GeneID  404734
Symbol  ANKHD1-EIF4EBP3
Synonyms  MASK-BP3|MASK-BP3arf
Description  ANKHD1-EIF4EBP3 readthrough transcript
See related  HGNC:33530|Ensembl:ENSG00000131503|HPRD:17468|
Locus tag  -
Gene type  protein-coding
Map location  5q31.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0032 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003723RNA bindingIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
NFKBIEIKBEnuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon-HPRD14743216 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1881881941Ahsa-miR-188CAUCCCUUGCAUGGUGGAGGGU
miR-4211731791Ahsa-miR-421GGCCUCAUUAAAUGUUUGUUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.