Gene Page

Home
Datasets
Search
Analysis & Tools
Documents
About SZGR
Quick search: (e.g. 207 or AKT)

Association Linkage Expression Literature GO_Annotation Gene Network miRNA Targets

Gene Ranking Integration

Association Linkage Expression Literature GO_Annotation Gene Network miRNA Targets Datasets Gene Ranking

Release Site Map Support Contact us

Gene Page: MDFI

Summary

GeneID

4188

Symbol

MDFI

Synonyms

I-MF|I-mfa

Description

MyoD family inhibitor

Locus tag

RP4-696P19.1

Gene type

protein-coding

Map location

6p21

Gene in Data Sources

Gene set name

Method of gene set

Evidence

Info

GSMA_I

genome scan meta-analysis

Psr: 0.033

GSMA_IIE

genome scan meta-analysis (European-ancestry samples)

Psr: 0.04433

Literature

High-throughput literature-search

Co-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]

Click to show detail

Network

Shortest path distance of core genes in the Human protein-protein interaction network

Contribution to shortest path in PPI network: 0.0074

General Gene Expression (microarray) ?

Gene Expression in Brain Regions (new)

Top co-expressed genes in Brain Regions (new)

Gene

Pearson's Correlation

Spearman's Correlation

Top 10 positively co-expressed genes

Top 10 negatively co-expressed genes

Gene Ontology

Molecular function

GO term

Evidence

Neuro keywords

PubMed ID

GO:0004872

receptor activity

IEA

GO:0008134

transcription factor binding

ISS

Biological process

GO term

Evidence

Neuro keywords

PubMed ID

GO:0000122

negative regulation of transcription from RNA polymerase II promoter

ISS

GO:0009950

dorsal/ventral axis specification

ISS

GO:0007257

activation of JNK activity

ISS

GO:0009790

embryonic development

TAS

8797820

GO:0030178

negative regulation of Wnt receptor signaling pathway

ISS

GO:0030154

cell differentiation

IEA

GO:0042994

cytoplasmic sequestering of transcription factor

TAS

8797820

GO:0043392

negative regulation of DNA binding

ISS

Cellular component

GO term

Evidence

Neuro keywords

PubMed ID

GO:0005634

nucleus

ISS

GO:0005737

cytoplasm

TAS

8797820

Protein-protein Interactions

Shown by network

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AASDHPPT	AASD-PPT \| CGI-80 \| DKFZp566E2346 \| LYS2 \| LYS5	aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase	Two-hybrid	BioGRID	16189514
AQP1	AQP-CHIP \| CHIP28 \| CO \| MGC26324	aquaporin 1 (Colton blood group)	Two-hybrid	BioGRID	16189514
AQP5	-	aquaporin 5	Two-hybrid	BioGRID	16189514
ATG12	APG12 \| APG12L \| FBR93 \| HAPG12	ATG12 autophagy related 12 homolog (S. cerevisiae)	Two-hybrid	BioGRID	16189514
BAALC	FLJ12015	brain and acute leukemia, cytoplasmic	Two-hybrid	BioGRID	16189514
BAHD1	KIAA0945	bromo adjacent homology domain containing 1	Two-hybrid	BioGRID	16189514
C10orf62	bA548K23.1	chromosome 10 open reading frame 62	Two-hybrid	BioGRID	16189514
C12orf12	MGC26598	chromosome 12 open reading frame 12	Two-hybrid	BioGRID	16189514
C16orf48	DAKV6410 \| DKFZp434A1319	chromosome 16 open reading frame 48	Two-hybrid	BioGRID	16189514
C18orf45	FLJ44259 \| MGC11386 \| MGC138577	chromosome 18 open reading frame 45	Two-hybrid	BioGRID	16189514
C18orf56	-	chromosome 18 open reading frame 56	Two-hybrid	BioGRID	16189514
C19orf60	FLJ20850 \| FLJ30108 \| FLJ34606 \| FLJ37391	chromosome 19 open reading frame 60	Two-hybrid	BioGRID	16189514
C1orf65	FLJ35728 \| RP11-76K24.1	chromosome 1 open reading frame 65	Two-hybrid	BioGRID	16189514
C6orf165	FLJ25974 \| dJ382I10.1	chromosome 6 open reading frame 165	Two-hybrid	BioGRID	16189514
C8orf48	FLJ25402	chromosome 8 open reading frame 48	Two-hybrid	BioGRID	16189514
C9orf86	FLJ10101 \| FLJ13045 \| Parf \| RBEL1 \| bA216L13.9 \| pp8875	chromosome 9 open reading frame 86	Affinity Capture-Western Two-hybrid	BioGRID	16189514
CATSPER1	CATSPER \| MGC33335 \| MGC33368	cation channel, sperm associated 1	Two-hybrid	BioGRID	16189514
CBFA2T2	DKFZp313F2116 \| EHT \| MTGR1 \| ZMYND3	core-binding factor, runt domain, alpha subunit 2; translocated to, 2	Two-hybrid	BioGRID	16189514
CBX2	CDCA6 \| M33 \| MGC10561	chromobox homolog 2 (Pc class homolog, Drosophila)	Two-hybrid	BioGRID	16189514
CCDC116	FLJ36046	coiled-coil domain containing 116	Two-hybrid	BioGRID	16189514
CCDC120	JM11	coiled-coil domain containing 120	Two-hybrid	BioGRID	16189514
CHIC2	BTL \| MGC21173	cysteine-rich hydrophobic domain 2	Two-hybrid	BioGRID	16189514
CNNM3	ACDP3 \| DKFZp434I1016 \| FLJ20018	cyclin M3	Two-hybrid	BioGRID	16189514
CPSF3L	CPSF73L \| FLJ13294 \| FLJ20542 \| INT11 \| INTS11 \| RC-68 \| RC68	cleavage and polyadenylation specific factor 3-like	Two-hybrid	BioGRID	16189514
CRX	CORD2 \| CRD \| LCA7 \| OTX3	cone-rod homeobox	Two-hybrid	BioGRID	16189514
CRY1	PHLL1	cryptochrome 1 (photolyase-like)	Two-hybrid	BioGRID	16189514
DDX19A	DDX19-DDX19L \| DDX19L \| DKFZp686C21137 \| FLJ11126	DEAD (Asp-Glu-Ala-As) box polypeptide 19A	Two-hybrid	BioGRID	16189514
DHRS1	DKFZp586I0523 \| FLJ14250 \| FLJ25430 \| MGC20204	dehydrogenase/reductase (SDR family) member 1	Two-hybrid	BioGRID	16189514
DKK1	DKK-1 \| SK	dickkopf homolog 1 (Xenopus laevis)	Two-hybrid	BioGRID	16189514
DNPEP	ASPEP \| DAP	aspartyl aminopeptidase	Two-hybrid	BioGRID	16189514
DUSP6	MKP3 \| PYST1	dual specificity phosphatase 6	Two-hybrid	BioGRID	16189514
EBI3	IL27B	Epstein-Barr virus induced 3	Two-hybrid	BioGRID	16189514
EWSR1	EWS	Ewing sarcoma breakpoint region 1	Two-hybrid	BioGRID	16189514
FAM124B	FLJ22746	family with sequence similarity 124B	Two-hybrid	BioGRID	16189514
FAM27E3	MGC149559 \| MGC42630	family with sequence similarity 27, member E3	Two-hybrid	BioGRID	16189514
FASTK	FAST	Fas-activated serine/threonine kinase	Two-hybrid	BioGRID	16189514
FBXW5	DKFZp434B205 \| Fbw5 \| MGC20962 \| RP11-229P13.10	F-box and WD repeat domain containing 5	Two-hybrid	BioGRID	16189514
FZD9	CD349 \| FZD3	frizzled homolog 9 (Drosophila)	Two-hybrid	BioGRID	16189514
GNAI2	GIP \| GNAI2B \| H_LUCA15.1 \| H_LUCA16.1	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2	Affinity Capture-Western Two-hybrid	BioGRID	16189514
GPRIN2	GRIN2 \| KIAA0514 \| MGC15171	G protein regulated inducer of neurite outgrowth 2	Two-hybrid	BioGRID	16189514
HOXA1	BSAS \| HOX1 \| HOX1F \| MGC45232	homeobox A1	Two-hybrid	BioGRID	16189514
HOXB9	HOX-2.5 \| HOX2 \| HOX2E	homeobox B9	Two-hybrid	BioGRID	16189514
ILF3	CBTF \| DRBF \| DRBP76 \| MMP4 \| MPHOSPH4 \| MPP4 \| NF-AT-90 \| NF110 \| NF90 \| NFAR \| NFAR-1 \| NFAR2 \| TCP110 \| TCP80	interleukin enhancer binding factor 3, 90kDa	Two-hybrid	BioGRID	16189514
IQUB	FLJ35834 \| MGC149284 \| MGC149285	IQ motif and ubiquitin domain containing	Affinity Capture-Western Two-hybrid	BioGRID	16189514
KIAA0408	FLJ43995 \| RP3-403A15.2	KIAA0408	Two-hybrid	BioGRID	16189514
KIAA0415	-	KIAA0415	Two-hybrid	BioGRID	16189514
LASP1	Lasp-1 \| MLN50	LIM and SH3 protein 1	Two-hybrid	BioGRID	16189514
LMO3	DAT1 \| MGC26081 \| RBTN3 \| RBTNL2 \| RHOM3 \| Rhom-3	LIM domain only 3 (rhombotin-like 2)	Two-hybrid	BioGRID	16189514
LRCH4	FLJ40101 \| FLJ46315 \| LRN \| LRRN1 \| LRRN4 \| PP14183 \| SAP25	leucine-rich repeats and calponin homology (CH) domain containing 4	Two-hybrid	BioGRID	16189514
LRDD	DKFZp434D229 \| MGC16925 \| PIDD	leucine-rich repeats and death domain containing	Two-hybrid	BioGRID	16189514
LRRN4	C20orf75 \| FLJ23994 \| MGC25027 \| NLRR4 \| dJ1056H1.1	leucine rich repeat neuronal 4	Two-hybrid	BioGRID	16189514
MCM5	CDC46 \| MGC5315 \| P1-CDC46	minichromosome maintenance complex component 5	Two-hybrid	BioGRID	16189514
MDFI	I-MF \| I-mfa	MyoD family inhibitor	Two-hybrid	BioGRID	16189514
METT11D1	FLJ20859	methyltransferase 11 domain containing 1	Two-hybrid	BioGRID	16189514
MFSD3	-	major facilitator superfamily domain containing 3	Two-hybrid	BioGRID	16189514
MGC21881	-	hypothetical locus MGC21881	Two-hybrid	BioGRID	16189514
MYF5	bHLHc2	myogenic factor 5	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	8797820
MYOD1	MYF3 \| MYOD \| PUM \| bHLHc1	myogenic differentiation 1	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	8797820
MYOG	MYF4 \| MYOGENIN \| bHLHc3	myogenin (myogenic factor 4)	-	HPRD,BioGRID	8797820
NPDC1	CAB \| CAB- \| CAB-1 \| CAB1 \| DKFZp586J0523	neural proliferation, differentiation and control, 1	Two-hybrid	BioGRID	16189514
NR1H2	LXR-b \| LXRB \| NER \| NER-I \| RIP15 \| UNR	nuclear receptor subfamily 1, group H, member 2	Two-hybrid	BioGRID	16189514
OTX1	FLJ38361 \| MGC15736	orthodenticle homeobox 1	Two-hybrid	BioGRID	16189514
PGLS	6PGL	6-phosphogluconolactonase	Affinity Capture-Western Two-hybrid	BioGRID	16189514
PHLDA1	DT1P1B11 \| MGC131738 \| PHRIP \| TDAG51	pleckstrin homology-like domain, family A, member 1	Two-hybrid	BioGRID	16189514
PIN1	DOD \| UBL5	peptidylprolyl cis/trans isomerase, NIMA-interacting 1	Two-hybrid	BioGRID	16189514
PVRL2	CD112 \| HVEB \| PRR2 \| PVRR2	poliovirus receptor-related 2 (herpesvirus entry mediator B)	Two-hybrid	BioGRID	16189514
RFX2	FLJ14226	regulatory factor X, 2 (influences HLA class II expression)	Two-hybrid	BioGRID	16189514
SERF2	4F5REL \| FAM2C \| FLJ20431 \| FLJ37527 \| FLJ38557 \| H4F5rel \| HsT17089 \| MGC48826	small EDRK-rich factor 2	Two-hybrid	BioGRID	16189514
SFI1	MGC131712 \| MGC150663 \| MGC156283 \| MGC57874 \| PISD \| RP5-858B16.1 \| hSfi1p	Sfi1 homolog, spindle assembly associated (yeast)	Two-hybrid	BioGRID	16189514
SFRS17A	721P \| CCDC133 \| CXYorf3 \| DXYS155E \| MGC125365 \| MGC125366 \| MGC39904 \| XE7 \| XE7Y	splicing factor, arginine/serine-rich 17A	Two-hybrid	BioGRID	16189514
SIX1	BOS3 \| DFNA23 \| TIP39	SIX homeobox 1	Affinity Capture-Western Two-hybrid	BioGRID	16189514
SLC35A2	UGALT \| UGAT \| UGT \| UGT1 \| UGT2 \| UGTL	solute carrier family 35 (UDP-galactose transporter), member A2	Two-hybrid	BioGRID	16189514
SLC9A1	APNH \| FLJ42224 \| NHE1	solute carrier family 9 (sodium/hydrogen exchanger), member 1	Two-hybrid	BioGRID	16189514
SPG7	CAR \| CMAR \| FLJ37308 \| MGC126331 \| MGC126332 \| PGN \| SPG5C	spastic paraplegia 7 (pure and complicated autosomal recessive)	Two-hybrid	BioGRID	16189514
TAP1	ABC17 \| ABCB2 \| APT1 \| D6S114E \| FLJ26666 \| FLJ41500 \| PSF1 \| RING4 \| TAP1*0102N \| TAP1N	transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)	Two-hybrid	BioGRID	16189514
THAP7	MGC10963	THAP domain containing 7	Two-hybrid	BioGRID	16189514
THEG	MGC26138	Theg homolog (mouse)	Two-hybrid	BioGRID	16189514
TINAGL1	ARG1 \| LCN7 \| LIECG3 \| TINAGRP	tubulointerstitial nephritis antigen-like 1	Two-hybrid	BioGRID	16189514
TRAF3IP2	ACT1 \| C6orf2 \| C6orf4 \| C6orf5 \| C6orf6 \| CIKS \| DKFZp586G0522 \| MGC3581	TRAF3 interacting protein 2	Two-hybrid	BioGRID	16189514
TRPV6	ABP/ZF \| CAT1 \| CATL \| ECAC2 \| HSA277909 \| LP6728 \| ZFAB	transient receptor potential cation channel, subfamily V, member 6	Two-hybrid	BioGRID	16189514
VPS72	CFL1 \| Swc2 \| TCFL1 \| YL-1 \| YL1	vacuolar protein sorting 72 homolog (S. cerevisiae)	Two-hybrid	BioGRID	16189514
WDR42A	DKFZp781G1096 \| FLJ35857 \| H326 \| MGC117276 \| MGC118891 \| MGC99640	WD repeat domain 42A	Two-hybrid	BioGRID	16189514
WDYHV1	C8orf32 \| FLJ10204	WDYHV motif containing 1	Two-hybrid	BioGRID	16189514
ZBTB24	BIF1 \| PATZ2 \| ZNF450	zinc finger and BTB domain containing 24	Two-hybrid	BioGRID	16189514
ZBTB25	KUP \| ZNF46	zinc finger and BTB domain containing 25	Affinity Capture-Western Two-hybrid	BioGRID	16189514
ZNF101	DKFZp570I0164 \| HZF12 \| MGC149565 \| MGC149566	zinc finger protein 101	Two-hybrid	BioGRID	16189514
ZNF136	pHZ-20	zinc finger protein 136	Two-hybrid	BioGRID	16189514
ZNF205	ZNF210 \| Zfp13	zinc finger protein 205	Two-hybrid	BioGRID	16189514
ZNF408	FLJ12827	zinc finger protein 408	Two-hybrid	BioGRID	16189514
ZNF417	MGC34079	zinc finger protein 417	Two-hybrid	BioGRID	16189514
ZNF426	MGC2663	zinc finger protein 426	Two-hybrid	BioGRID	16189514
ZNF439	DKFZp571K0837	zinc finger protein 439	Two-hybrid	BioGRID	16189514
ZNF440	FLJ37933	zinc finger protein 440	Two-hybrid	BioGRID	16189514
ZNF559	MGC13105 \| Nbla00121	zinc finger protein 559	Two-hybrid	BioGRID	16189514
ZNF581	FLJ22550 \| HSPC189	zinc finger protein 581	Two-hybrid	BioGRID	16189514
ZNF607	FLJ14802 \| MGC13071	zinc finger protein 607	Two-hybrid	BioGRID	16189514
ZNF646	KIAA0296	zinc finger protein 646	Two-hybrid	BioGRID	16189514
ZNF679	MGC42415	zinc finger protein 679	Two-hybrid	BioGRID	16189514
ZNF707	-	zinc finger protein 707	Two-hybrid	BioGRID	16189514
ZNF764	MGC13138	zinc finger protein 764	Two-hybrid	BioGRID	16189514

miRNA Targets ?

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	381	387	m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-145	592	598	1A	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-23	442	449	1A,m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	442	449	1A,m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-323	442	448	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.