SZGR2

Summary ?

GeneID	4192
Symbol	MDK
Synonyms	ARAP\|MK\|NEGF2
Description	midkine (neurite growth-promoting factor 2)
Reference	MIM:162096\|HGNC:HGNC:6972\|Ensembl:ENSG00000110492\|HPRD:01200\|Vega:OTTHUMG00000150315
Gene type	protein-coding
Map location	11p11.2
Pascal p-value	2.765E-10
Sherlock p-value	0.639
Fetal beta	0.985
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg00078194	11	46402949	MDK	2.84E-5	-0.2	0.018	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs17195543	chr11	45509795	MDK	4192	0.02	cis
rs947242	chr1	58042848	MDK	4192	0.05	trans
rs631503	chr1	72327801	MDK	4192	0.06	trans
rs11205098	chr1	152717431	MDK	4192	6.48E-4	trans
rs7518178	chr1	199424428	MDK	4192	0.18	trans
rs3013450	chr1	214552423	MDK	4192	0.08	trans
rs2374323	chr2	41898671	MDK	4192	5.147E-4	trans
rs17486127	chr2	72111878	MDK	4192	0	trans
rs17558168	chr2	72151944	MDK	4192	0	trans
rs7562379	chr2	76693222	MDK	4192	0.14	trans
rs4338920	chr2	141325591	MDK	4192	0.04	trans
rs222809	chr2	146893189	MDK	4192	0.07	trans
rs6726013	chr2	189064570	MDK	4192	2.414E-4	trans
rs6729020	chr2	189064719	MDK	4192	6.202E-6	trans
rs10166301	chr2	189947813	MDK	4192	0	trans
rs4680999	chr3	78613401	MDK	4192	0.11	trans
rs17088743	chr4	58668728	MDK	4192	0.01	trans
rs4425392	chr4	133569611	MDK	4192	0.17	trans
rs35129	chr5	6039853	MDK	4192	0.09	trans
rs447967	chr5	9999056	MDK	4192	0.14	trans
rs6874831	chr5	59155059	MDK	4192	4.156E-8	trans
rs7728346	chr5	59155166	MDK	4192	8.123E-10	trans
rs16890314	chr5	59158770	MDK	4192	4.597E-7	trans
rs10214307	chr5	59159746	MDK	4192	4.156E-8	trans
rs6893381	chr5	59160568	MDK	4192	9.95E-7	trans
rs10052099	chr5	99324715	MDK	4192	0.05	trans
rs10074374	chr5	99324809	MDK	4192	0.08	trans
rs545290	chr5	152858437	MDK	4192	0.08	trans
rs2294670	chr6	625834	MDK	4192	0.01	trans
rs9451867	chr6	92659609	MDK	4192	0.01	trans
rs9640055	chr7	8029515	MDK	4192	0.05	trans
rs17142255	chr7	8075258	MDK	4192	0.09	trans
rs1014201	chr7	25815736	MDK	4192	0.05	trans
rs2939687	chr8	56313877	MDK	4192	0.11	trans
rs10123219	chr9	74156668	MDK	4192	0.03	trans
rs4601388	chr9	94547922	MDK	4192	1.187E-4	trans
rs2006996	chr9	117592637	MDK	4192	0.16	trans
rs2229360	chr10	8116078	MDK	4192	0.15	trans
rs2225536	chr10	110354957	MDK	4192	0.16	trans
rs7933582	chr11	91178991	MDK	4192	0.14	trans
rs7953537	chr12	44693287	MDK	4192	0.07	trans
rs17094401	chr12	44696783	MDK	4192	0.19	trans
rs17094560	chr12	44769767	MDK	4192	0.07	trans
rs8013004	chr14	41098282	MDK	4192	0.01	trans
rs8013037	chr14	41098343	MDK	4192	0.11	trans
rs17105664	chr14	68926192	MDK	4192	0.18	trans
rs1515411	chr14	90614916	MDK	4192	0.16	trans
rs4457950	chr15	35445709	MDK	4192	0.06	trans
rs16969948	chr15	78864785	MDK	4192	0.14	trans
rs4550511	chr17	53340407	MDK	4192	0.18	trans
rs8071763	chr17	67930673	MDK	4192	3.829E-4	trans
rs7244040	chr18	13972023	MDK	4192	8.92E-8	trans
rs17681878	chr18	34767223	MDK	4192	0.18	trans
rs515453	chr18	72483272	MDK	4192	0.12	trans
rs4536719	chr20	24397114	MDK	4192	8.406E-4	trans
rs7887127	chrX	38436019	MDK	4192	1.645E-4	trans
rs871948	chrX	39342814	MDK	4192	7.043E-4	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
NEBL	0.87	0.87
EPB41L2	0.86	0.90
MFAP3L	0.85	0.89
ACSL6	0.85	0.89
MYLK	0.85	0.82
SYNM	0.84	0.89
SIRPA	0.84	0.91
KIAA0494	0.84	0.83
DTNA	0.84	0.87
TACC1	0.82	0.88

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
TUBB2B	-0.62	-0.55
KIAA1949	-0.62	-0.49
BCL7C	-0.62	-0.71
NXT1	-0.62	-0.66
RPS8	-0.61	-0.75
RPS19P3	-0.61	-0.78
RPS13P2	-0.61	-0.73
TRAF4	-0.61	-0.66
DYNLT1	-0.61	-0.74
ALKBH2	-0.61	-0.63

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008201	heparin binding	IDA		9384573
GO:0008083	growth factor activity	IEA		-
GO:0008083	growth factor activity	NAS		1639750
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007399	nervous system development	NAS	neurite (GO term level: 5)	9384573
GO:0007165	signal transduction	NAS		7835084
GO:0008283	cell proliferation	IEA		-
GO:0009611	response to wounding	ISS		-
GO:0007275	multicellular organismal development	IEA		-
GO:0030154	cell differentiation	NAS		1639750
GO:0030325	adrenal gland development	ISS		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACTG1	ACT \| ACTG \| DFNA20 \| DFNA26	actin, gamma 1	Affinity Capture-MS	BioGRID	10772929
JAK1	JAK1A \| JAK1B \| JTK3	Janus kinase 1 (a protein tyrosine kinase)	-	HPRD	9452495
JAK2	JTK10	Janus kinase 2 (a protein tyrosine kinase)	-	HPRD	9452495
LRP1	A2MR \| APOER \| APR \| CD91 \| FLJ16451 \| IGFBP3R \| LRP \| MGC88725 \| TGFBR5	low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor)	-	HPRD,BioGRID	10772929
LRP2	DBS \| gp330	low density lipoprotein-related protein 2	-	HPRD	10772929
NCAM1	CD56 \| MSK39 \| NCAM	neural cell adhesion molecule 1	Affinity Capture-MS	BioGRID	10772929
NCL	C23 \| FLJ45706	nucleolin	-	HPRD,BioGRID	12147681
NID1	NID	nidogen 1	Affinity Capture-MS	BioGRID	10772929
NID2	-	nidogen 2 (osteonidogen)	Affinity Capture-MS	BioGRID	10772929
PTPRB	DKFZp686E2262 \| DKFZp686H15164 \| FLJ44133 \| HPTP-BETA \| HPTPB \| MGC142023 \| MGC59935 \| PTPB \| R-PTP-BETA \| VEPTP	protein tyrosine phosphatase, receptor type, B	-	HPRD	10706604
PTPRZ1	HPTPZ \| HPTPzeta \| PTP-ZETA \| PTP18 \| PTPRZ \| PTPZ \| RPTPB \| RPTPbeta \| phosphacan	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	-	HPRD,BioGRID	10212223 \|10706604
RPL18A	-	ribosomal protein L18a	Two-hybrid	BioGRID	16169070
SDC1	CD138 \| SDC \| SYND1 \| syndecan	syndecan 1	-	HPRD	9089390
SDC3	N-syndecan \| SDCN \| SYND3	syndecan 3	-	HPRD	9089390
SDC4	MGC22217 \| SYND4	syndecan 4	-	HPRD	8621465
STAT1	DKFZp686B04100 \| ISGF-3 \| STAT91	signal transducer and activator of transcription 1, 91kDa	-	HPRD	9452495
TGM1	ICR2 \| KTG \| LI \| LI1 \| TGASE \| TGK	transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)	-	HPRD	9384573
TUBA1A	B-ALPHA-1 \| FLJ25113 \| LIS3 \| TUBA3	tubulin, alpha 1a	Affinity Capture-MS	BioGRID	10772929
TUBB2B	DKFZp566F223 \| FLJ98847 \| MGC8685 \| TUBB-PARALOG \| bA506K6.1	tubulin, beta 2B	Affinity Capture-MS	BioGRID	10772929

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID INTEGRIN1 PATHWAY	66	44	All SZGR 2.0 genes in this pathway
PID SYNDECAN 4 PATHWAY	32	25	All SZGR 2.0 genes in this pathway
PID INTEGRIN A4B1 PATHWAY	33	24	All SZGR 2.0 genes in this pathway
SCHUETZ BREAST CANCER DUCTAL INVASIVE DN	84	53	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 DN	242	165	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 DN	281	186	All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP	443	294	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 4 5WK UP	271	175	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL DN	186	107	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 TTD UP	64	39	All SZGR 2.0 genes in this pathway
ROVERSI GLIOMA COPY NUMBER UP	100	75	All SZGR 2.0 genes in this pathway
LI AMPLIFIED IN LUNG CANCER	178	108	All SZGR 2.0 genes in this pathway
LUI THYROID CANCER CLUSTER 1	51	33	All SZGR 2.0 genes in this pathway
KORKOLA YOLK SAC TUMOR	62	33	All SZGR 2.0 genes in this pathway
DACOSTA ERCC3 ALLELE XPCS VS TTD UP	28	19	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 UP	309	199	All SZGR 2.0 genes in this pathway
HEIDENBLAD AMPLICON 8Q24 DN	46	28	All SZGR 2.0 genes in this pathway
FURUKAWA DUSP6 TARGETS PCI35 UP	74	32	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
ROZANOV MMP14 TARGETS SUBSET	33	20	All SZGR 2.0 genes in this pathway
ROZANOV MMP14 TARGETS UP	266	171	All SZGR 2.0 genes in this pathway
SHEPARD BMYB MORPHOLINO DN	200	112	All SZGR 2.0 genes in this pathway
SHEPARD BMYB TARGETS	74	41	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP	398	262	All SZGR 2.0 genes in this pathway
SHEPARD CRUSH AND BURN MUTANT DN	185	111	All SZGR 2.0 genes in this pathway
HADDAD T LYMPHOCYTE AND NK PROGENITOR UP	78	56	All SZGR 2.0 genes in this pathway
LEI MYB TARGETS	318	215	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD1 AND CD2 UP	89	51	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP	249	170	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS UP	37	27	All SZGR 2.0 genes in this pathway
KANG FLUOROURACIL RESISTANCE UP	22	15	All SZGR 2.0 genes in this pathway
BANDRES RESPONSE TO CARMUSTIN MGMT 24HR DN	33	21	All SZGR 2.0 genes in this pathway
ZHANG ANTIVIRAL RESPONSE TO RIBAVIRIN UP	30	21	All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX DN	88	58	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP	428	266	All SZGR 2.0 genes in this pathway
JIANG HYPOXIA NORMAL	311	205	All SZGR 2.0 genes in this pathway
BANDRES RESPONSE TO CARMUSTIN WITHOUT MGMT 48HR DN	32	25	All SZGR 2.0 genes in this pathway
BANDRES RESPONSE TO CARMUSTIN MGMT 48HR DN	161	105	All SZGR 2.0 genes in this pathway
BACOLOD RESISTANCE TO ALKYLATING AGENTS UP	26	17	All SZGR 2.0 genes in this pathway
WANG LSD1 TARGETS UP	24	14	All SZGR 2.0 genes in this pathway
KANG CISPLATIN RESISTANCE UP	19	11	All SZGR 2.0 genes in this pathway
SASAI TARGETS OF CXCR6 AND PTCH1 DN	8	6	All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS DN	138	92	All SZGR 2.0 genes in this pathway
YAMASHITA LIVER CANCER WITH EPCAM UP	53	25	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION	368	247	All SZGR 2.0 genes in this pathway
CAIRO LIVER DEVELOPMENT UP	166	105	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 12	79	54	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT	567	365	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 UP	140	94	All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES	462	273	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY	1725	838	All SZGR 2.0 genes in this pathway
NABA SECRETED FACTORS	344	197	All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED	753	411	All SZGR 2.0 genes in this pathway
NABA MATRISOME	1028	559	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124/506	90	96	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	90	96	m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MDK