Gene Page: MIP
Summary ?
GeneID | 4284 |
Symbol | MIP |
Synonyms | AQP0|CTRCT15|LIM1|MIP26|MP26 |
Description | major intrinsic protein of lens fiber |
Reference | MIM:154050|HGNC:HGNC:7103|Ensembl:ENSG00000135517|HPRD:01098|Vega:OTTHUMG00000170571 |
Gene type | protein-coding |
Map location | 12q13 |
Pascal p-value | 0.002 |
Fetal beta | -0.095 |
eGene | Cerebellum Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0024 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs10994209 | chr10 | 61877705 | MIP | 4284 | 0.07 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005524 | ATP binding | IEA | - | |
GO:0004672 | protein kinase activity | IEA | - | |
GO:0005212 | structural constituent of eye lens | IEA | - | |
GO:0005215 | transporter activity | TAS | 1840563 | |
GO:0015250 | water channel activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0002088 | lens development in camera-type eye | IEA | - | |
GO:0006468 | protein amino acid phosphorylation | IEA | - | |
GO:0007601 | visual perception | IEA | - | |
GO:0006833 | water transport | IEA | - | |
GO:0006810 | transport | IEA | - | |
GO:0050896 | response to stimulus | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005921 | gap junction | IEA | - | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 1840563 | |
GO:0030054 | cell junction | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME TRANSMEMBRANE TRANSPORT OF SMALL MOLECULES | 413 | 270 | All SZGR 2.0 genes in this pathway |
REACTOME PASSIVE TRANSPORT BY AQUAPORINS | 11 | 7 | All SZGR 2.0 genes in this pathway |
REACTOME AQUAPORIN MEDIATED TRANSPORT | 51 | 34 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
MIKKELSEN IPS LCP WITH H3K4ME3 | 174 | 100 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES LCP WITH H3K4ME3 | 142 | 80 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-181 | 255 | 261 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-186 | 102 | 108 | 1A | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
miR-363 | 195 | 201 | 1A | hsa-miR-363 | AUUGCACGGUAUCCAUCUGUAA |
miR-377 | 157 | 164 | 1A,m8 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
miR-452 | 196 | 202 | m8 | hsa-miR-452 | UGUUUGCAGAGGAAACUGAGAC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.