Gene Page: CD200

Summary
GeneID  4345
Symbol  CD200
Synonyms  MOX1|MOX2|MRC|OX-2
Description  CD200 molecule
See related  HGNC:7203|MIM:155970|Ensembl:ENSG00000091972|
Locus tag  -
Gene type  protein-coding
Map location  3q12-q13
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.04359 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.04047 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005886plasma membraneIEA-
GO:0005887integral to plasma membraneTAS3032785 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CD200R1CD200R | HCRTR2 | MOX2R | OX2RCD200 receptor 1-HPRD,BioGRID10981966 |12960329 
HCRTR2OX2Rhypocretin (orexin) receptor 2-HPRD10981966 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-2638451A,m8hsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
miR-38411191125m8hsa-miR-384AUUCCUAGAAAUUGUUCAUA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.