Gene Page: NEDD8

Summary
GeneID  4738
Symbol  NEDD8
Synonyms  FLJ43224|MGC104393|MGC125896|MGC125897|Nedd-8
Description  neural precursor cell expressed, developmentally down-regulated 8
See related  HGNC:7732|MIM:603171|Ensembl:ENSG00000129559|HPRD:04412|
Locus tag  -
Gene type  protein-coding
Map location  14q12
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.047 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI15567417 |17353931 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006357regulation of transcription from RNA polymerase II promoterIEA-
GO:0006464protein modification processTAS9694792 
GO:0006508proteolysisTAS9694792 
GO:0006511ubiquitin-dependent protein catabolic processTAS9353319 
GO:0009653anatomical structure morphogenesisTAS9694792 
GO:0008104protein localizationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusTAS9353319 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AHR-aryl hydrocarbon receptor-HPRD,BioGRID12215427 
CDC34E2-CDC34 | UBC3 | UBE2R1cell division cycle 34 homolog (S. cerevisiae)-HPRD11675391 
CDK2p33(CDK2)cyclin-dependent kinase 2Affinity Capture-MSBioGRID17353931 
CUL3-cullin 3-HPRD10500095 
CUL4A-cullin 4AAffinity Capture-MSBioGRID12481031 
FBXO4DKFZp547N213 | FBX4 | FLJ10141F-box protein 4Affinity Capture-MSBioGRID17353931 
MAGED1DLXIN-1 | NRAGEmelanoma antigen family D, 1Affinity Capture-MSBioGRID17353931 
NUB1BS4 | NUB1L | NYREN18negative regulator of ubiquitin-like proteins 1Affinity Capture-Western
Reconstituted Complex
BioGRID11585840 |14757770 
-HPRD11259415 
PSMD4AF | AF-1 | ASF | MCB1 | Rpn10 | S5A | pUB-R5proteasome (prosome, macropain) 26S subunit, non-ATPase, 4-HPRD,BioGRID11585840 
RBX1BA554C12.1 | MGC13357 | MGC1481 | RNF75 | ROC1ring-box 1Affinity Capture-MSBioGRID12481031 
TFE3RCCP2 | TFEA | bHLHe33transcription factor binding to IGHM enhancer 3Affinity Capture-MSBioGRID17353931 
UBA2ARX | FLJ13058 | HRIHFB2115 | SAE2ubiquitin-like modifier activating enzyme 2-HPRD,BioGRID10217437 
UBA3DKFZp566J164 | MGC22384 | UBE1C | hUBA3ubiquitin-like modifier activating enzyme 3-HPRD,BioGRID10207026 
UBE2KDKFZp564C1216 | DKFZp686J24237 | E2-25K | HIP2 | HYPG | LIGubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast)-HPRD9857030 
UBE2MUBC-RS2 | UBC12 | hUbc12ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast)-HPRD,BioGRID10828074 
UCHL1PARK5 | PGP9.5 | Uch-L1ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)Two-hybridBioGRID16169070 
UCHL3UCH-L3ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)-HPRD,BioGRID9790970 
VHLHRCA1 | RCA1 | VHL1von Hippel-Lindau tumor suppressorAffinity Capture-MSBioGRID17353931 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1501241301Ahsa-miR-150UCUCCCAACCCUUGUACCAGUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.