Gene Page: NONO

Summary
GeneID  4841
Symbol  NONO
Synonyms  NMT55|NRB54|P54|P54NRB
Description  non-POU domain containing, octamer-binding
See related  HGNC:7871|MIM:300084|Ensembl:ENSG00000147140|HPRD:02098|
Locus tag  -
Gene type  protein-coding
Map location  Xq13.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenic, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003677DNA bindingIEA-
GO:0003723RNA bindingIEA-
GO:0042802identical protein bindingIPI16148043 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006397mRNA processingTAS9360842 
GO:0006350transcriptionIEA-
GO:0006310DNA recombinationIEA-
GO:0008380RNA splicingTAS8371983 
GO:0006281DNA repairIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusTAS9360842 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARAIS | DHTR | HUMARA | KD | NR3C4 | SBMA | SMAX1 | TFMandrogen receptor-HPRD,BioGRID12810069 
CA2CA-II | CAII | Car2carbonic anhydrase IIReconstituted ComplexBioGRID10821857 
FXR2FMR1L2fragile X mental retardation, autosomal homolog 2Two-hybridBioGRID16189514 
MAD1L1HsMAD1 | MAD1 | PIG9 | TP53I9 | TXBP181MAD1 mitotic arrest deficient-like 1 (yeast)Two-hybridBioGRID16189514 
NONONMT55 | NRB54 | P54 | P54NRBnon-POU domain containing, octamer-bindingTwo-hybridBioGRID16189514 
PCNAMGC8367proliferating cell nuclear antigenNONO is a PCNA-binding proteinBIND12171929 
PIN1DOD | UBL5peptidylprolyl cis/trans isomerase, NIMA-interacting 1Two-hybridBioGRID16189514 
PLEKHF2FLJ13187 | PHAFIN2 | ZFYVE18pleckstrin homology domain containing, family F (with FYVE domain) member 2Two-hybridBioGRID16189514 
POLR2AMGC75453 | POLR2 | POLRA | RPB1 | RPBh1 | RPO2 | RPOL2 | RpIILS | hRPB220 | hsRPB1polymerase (RNA) II (DNA directed) polypeptide A, 220kDain vitro
in vivo		BioGRID12358429 
PSPC1DKFZp566B1447 | FLJ10955 | PSP1paraspeckle component 1Two-hybridBioGRID16169070 
SFPQPOMP100 | PSFsplicing factor proline/glutamine-rich (polypyrimidine tract binding protein associated)PSF interacts with p54nrbBIND9756848 
-HPRD,BioGRID12403470 
SPI1OF | PU.1 | SFPI1 | SPI-1 | SPI-Aspleen focus forming virus (SFFV) proviral integration oncogene spi1-HPRD,BioGRID8626664 
ZNRD1HTEX-6 | MGC13376 | Rpa12 | TEX6 | hZR14 | tctex-6zinc ribbon domain containing 1Two-hybridBioGRID16189514 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-10907913m8hsa-miR-10aUACCCUGUAGAUCCGAAUUUGUG
hsa-miR-10bUACCCUGUAGAACCGAAUUUGU
miR-13610401046m8hsa-miR-136ACUCCAUUUGUUUUGAUGAUGGA
miR-141/200a78841Ahsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-14956621Ahsa-miR-149brainUCUGGCUCCGUGUCUUCACUCC
miR-320872878m8hsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-34/4495805861Ahsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.