Gene Page: IMPG2

Summary
GeneID  50939
Symbol  IMPG2
Synonyms  IPM200|SPACRCAN
Description  interphotoreceptor matrix proteoglycan 2
See related  HGNC:18362|MIM:607056|Ensembl:ENSG00000081148|HPRD:06135|
Locus tag  -
Gene type  protein-coding
Map location  3q12.2-q12.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.04359 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.04047 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityIEA-
GO:0005540hyaluronic acid bindingIEA-
GO:0008201heparin bindingIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-13642481Ahsa-miR-136ACUCCAUUUGUUUUGAUGAUGGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.