Gene Page: HAO2

Summary
GeneID  51179
Symbol  HAO2
Synonyms  GIG16|HAOX2
Description  hydroxyacid oxidase 2 (long chain)
See related  HGNC:4810|MIM:605176|Ensembl:ENSG00000116882|HPRD:05532|
Locus tag  RP5-871G17.1
Gene type  protein-coding
Map location  1p13.3-p13.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0235 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00814 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003973(S)-2-hydroxy-acid oxidase activityTAS10777549 
GO:0010181FMN bindingIEA-
GO:0009055electron carrier activityIEA-
GO:0016491oxidoreductase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001561fatty acid alpha-oxidationTAS10777549 
GO:0008152metabolic processIEA-
GO:0055114oxidation reductionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005777peroxisomeTAS10777549 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-3776672m8hsa-miR-377AUCACACAAAGGCAACUUUUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.