Gene Page: PLCE1

Summary
GeneID  51196
Symbol  PLCE1
Synonyms  FLJ23659|KIAA1516|MGC167842|NPHS3|PLCE
Description  phospholipase C, epsilon 1
See related  HGNC:17175|MIM:608414|Ensembl:ENSG00000138193|HPRD:07087|
Locus tag  RP11-76P2.1
Gene type  protein-coding
Map location  10q23
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 2.243 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005085guanyl-nucleotide exchange factor activityIEA-
GO:0005085guanyl-nucleotide exchange factor activityTAS11022047 
GO:0005057receptor signaling protein activityTAS11022048 
GO:0004871signal transducer activityIEA-
GO:0005509calcium ion bindingIEA-
GO:0004435phosphoinositide phospholipase C activityIDA11022047 |11022048 
GO:0004435phosphoinositide phospholipase C activityIEA-
GO:0016787hydrolase activityIEA-
GO:0017016Ras GTPase bindingTAS11022048 
GO:0019899enzyme bindingIPI11022048 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0000187activation of MAPK activityIDA11022047 
GO:0001558regulation of cell growthTAS11022047 
GO:0007204elevation of cytosolic calcium ion concentrationTAS11022047 
GO:0007205activation of protein kinase C activityNAS11022048 
GO:0007173epidermal growth factor receptor signaling pathwayNAS11022048 
GO:0016042lipid catabolic processIEA-
GO:0007010cytoskeleton organizationNAS11022047 
GO:0048016inositol phosphate-mediated signalingTAS11022047 
GO:0008283cell proliferationNAS11022048 
GO:0008277regulation of G-protein coupled receptor protein signaling pathwayIDA11022047 
GO:0007507heart developmentTAS11022047 
GO:0006940regulation of smooth muscle contractionTAS11022047 
GO:0006651diacylglycerol biosynthetic processTAS11022047 
GO:0006644phospholipid metabolic processIC11022048 
GO:0006629lipid metabolic processIEA-
GO:0007264small GTPase mediated signal transductionIEA-
GO:0019722calcium-mediated signalingNAS11022048 
GO:0019722calcium-mediated signalingTAS11022047 
GO:0032835glomerulus developmentIMP17086182 
GO:0045859regulation of protein kinase activityIDA11022047 
GO:0046578regulation of Ras protein signal transductionIDA11022047 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000139Golgi membraneIEA-
GO:0005794Golgi apparatusIEA-
GO:0005829cytosolIDA11022048 
GO:0005622intracellularIEA-
GO:0005624membrane fractionIDA11022047 |11022048 
GO:0005737cytoplasmIEA-
GO:0005886plasma membraneIDA11022048 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
NRASALPS4 | N-ras | NRAS1neuroblastoma RAS viral (v-ras) oncogene homologTwo-hybridBioGRID16169070 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-145961031A,m8hsa-miR-145GUCCAGUUUUCCCAGGAAUCCCUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.