Gene Page: BET1L

Summary
GeneID  51272
Symbol  BET1L
Synonyms  BET1L1|GOLIM3|GS15|HSPC197
Description  blocked early in transport 1 homolog (S. cerevisiae)-like
See related  HGNC:19348|Ensembl:ENSG00000177951|HPRD:16547|
Locus tag  -
Gene type  protein-coding
Map location  11p15.5
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005484SNAP receptor activityIDA15215310 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0015031protein transportIEA-
GO:0042147retrograde transport, endosome to GolgiIDA15215310 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0031201SNARE complexTASneuron, Synap (GO term level: 6)15215310 
GO:0000139Golgi membraneIEA-
GO:0005794Golgi apparatusIDA15215310 
GO:0005768endosomeIDA15215310 
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
COPAFLJ26320 | HEP-COPcoatomer protein complex, subunit alphaAffinity Capture-WesternBioGRID12388752 
GOSR1GOLIM2 | GOS-28 | GOS28 | GOS28/P28 | GS28 | P28golgi SNAP receptor complex member 1Affinity Capture-WesternBioGRID11927603 |12388752 
STX5SED5 | STX5Asyntaxin 5Affinity Capture-WesternBioGRID11927603 |12388752 
YKT6-YKT6 v-SNARE homolog (S. cerevisiae)-HPRD,BioGRID12388752 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-241661721Ahsa-miR-24SZUGGCUCAGUUCAGCAGGAACAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.