Gene Page: BFAR

Summary
GeneID  51283
Symbol  BFAR
Synonyms  BAR|RNF47
Description  bifunctional apoptosis regulator
See related  HGNC:17613|Ensembl:ENSG00000103429|HPRD:16548|
Locus tag  -
Gene type  protein-coding
Map location  16p13.12
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01775 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
GO:0005198structural molecule activityTAS10716992 
GO:0008270zinc ion bindingIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006916anti-apoptosisIDA10716992 
GO:0006915apoptosisIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005789endoplasmic reticulum membraneIEA-
GO:0005624membrane fractionIDA10716992 
GO:0005783endoplasmic reticulumIEA-
GO:0016020membraneIEA-
GO:0005887integral to plasma membraneTAS10716992 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
BCL2Bcl-2B-cell CLL/lymphoma 2-HPRD10716992 
CASP10ALPS2 | FLICE2 | MCH4caspase 10, apoptosis-related cysteine peptidase-HPRD10716992 
CASP8ALPS2B | CAP4 | FLICE | FLJ17672 | MACH | MCH5 | MGC78473caspase 8, apoptosis-related cysteine peptidase-HPRD10716992 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-15/16/195/424/497114120m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-3844434491Ahsa-miR-384AUUCCUAGAAAUUGUUCAUA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.