Gene Page: CDC40

Summary
GeneID  51362
Symbol  CDC40
Synonyms  EHB3|FLJ10564|MGC102802|PRP17|PRPF17
Description  cell division cycle 40 homolog (S. cerevisiae)
See related  HGNC:17350|MIM:605585|Ensembl:ENSG00000168438|HPRD:05721|
Locus tag  RP1-71D21.3
Gene type  protein-coding
Map location  6q21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.349 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0000398nuclear mRNA splicing, via spliceosomeEXP12226669 
GO:0008380RNA splicingTAS9524131 
GO:0051301cell divisionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005681spliceosomeTAS9524131 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
DHX38DDX38 | KIAA0224 | PRP16 | PRPF16DEAH (Asp-Glu-Ala-His) box polypeptide 38-HPRD9524131 
EPS15AF-1P | AF1P | MLLT5epidermal growth factor receptor pathway substrate 15The EH domain of Eps15 interacts with the NPF motif of ehb3. This interaction was modeled on a demonstrated interaction between mouse Eps15 and human ehb3.BIND9303539 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-23186618731A,m8hsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-30-3p272278m8hsa-miR-30a-3pCUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3pCUUUCAGUCGGAUGUUUACAGC
miR-323186618721Ahsa-miR-323brainGCACAUUACACGGUCGACCUCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.