Gene Page: SNX9

Summary
GeneID  51429
Symbol  SNX9
Synonyms  MST155|MSTP155|SDP1|SH3PX1|SH3PXD3A|WISP
Description  sorting nexin 9
See related  HGNC:14973|MIM:605952|Ensembl:ENSG00000130340|HPRD:12072|
Locus tag  RP11-266C7.10
Gene type  protein-coding
Map location  6q25.1-q26
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005070SH3/SH2 adaptor activityTAS10531379 
GO:0005515protein bindingIEA-
GO:0005515protein bindingIPI10531379 
GO:0035091phosphoinositide bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007154cell communicationIEA-
GO:0008104protein localizationTAS10531379 
GO:0006886intracellular protein transportIEA-
GO:0015031protein transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005792microsomeIEA-
GO:0005625soluble fractionIEA-
GO:0005737cytoplasmIEA-
GO:0005886plasma membraneIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ADAM12MCMP | MCMPMltna | MLTN | MLTNAADAM metallopeptidase domain 12-HPRD10531379 
ADAM15MDC15ADAM metallopeptidase domain 15-HPRD,BioGRID10531379 
ADAM9KIAA0021 | MCMP | MDC9 | MltngADAM metallopeptidase domain 9 (meltrin gamma)-HPRD,BioGRID10531379 
CLTCCHC | CHC17 | CLH-17 | CLTCL2 | Hc | KIAA0034clathrin, heavy chain (Hc)-HPRD,BioGRID11799118 |12952949 
DNM2CMTDI1 | CMTDIB | DI-CMTB | DYN2 | DYNIIdynamin 2Affinity Capture-MS
Affinity Capture-Western
BioGRID12952949 
MPHOSPH6MPP | MPP-6 | MPP6M-phase phosphoprotein 6-HPRD15231747 
MPP6PALS2 | VAM-1 | VAM1 | p55Tmembrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)Two-hybridBioGRID15231747 
SOS1GF1 | GGF1 | GINGF | HGF | NS4son of sevenless homolog 1 (Drosophila)-HPRD14679214 
SOS2FLJ25596son of sevenless homolog 2 (Drosophila)-HPRD14679214 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-493-5p157415811A,m8hsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.