Gene Page: HDAC7

Summary
GeneID  51564
Symbol  HDAC7
Synonyms  DKFZp586J0917|FLJ99588|HD7A|HDAC7A
Description  histone deacetylase 7
See related  HGNC:14067|MIM:606542|Ensembl:ENSG00000061273|HPRD:09133|
Locus tag  -
Gene type  protein-coding
Map location  12q13.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004407histone deacetylase activityTAS12711221 
GO:0016787hydrolase activityIEA-
GO:0008134transcription factor bindingTAS12711221 
GO:0016566specific transcriptional repressor activityTAS12711221 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007399nervous system developmentTASneurite (GO term level: 5)12711221 
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionIEA-
GO:0006954inflammatory responseTAS12711221 
GO:0016568chromatin modificationTAS12711221 
GO:0030183B cell differentiationTAS12711221 
GO:0045843negative regulation of striated muscle developmentTAS12711221 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000118histone deacetylase complexTAS12711221 
GO:0005634nucleusTAS12711221 
GO:0005737cytoplasmTAS12711221 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
BCL6BCL5 | BCL6A | LAZ3 | ZBTB27 | ZNF51B-cell CLL/lymphoma 6Affinity Capture-Western
Reconstituted Complex
BioGRID11929873 
EDNRAETA | ETRAendothelin receptor type AAffinity Capture-Western
Reconstituted Complex
Two-hybrid
BioGRID11262386 
HDAC3HD3 | RPD3 | RPD3-2histone deacetylase 3Affinity Capture-Western
Reconstituted Complex
BioGRID11466315 
IKZF1Hs.54452 | IK1 | IKAROS | LYF1 | PRO0758 | ZNFN1A1 | hIk-1IKAROS family zinc finger 1 (Ikaros)Affinity Capture-WesternBioGRID12015313 
IKZF3AIO | AIOLOS | ZNFN1A3IKAROS family zinc finger 3 (Aiolos)Affinity Capture-WesternBioGRID12015313 
IKZF4EOS | KIAA1782 | ZNFN1A4IKAROS family zinc finger 4 (Eos)Affinity Capture-WesternBioGRID12015313 
KAT5ESA1 | HTATIP | HTATIP1 | PLIP | TIP | TIP60 | cPLA2K(lysine) acetyltransferase 5Affinity Capture-Western
Two-hybrid
BioGRID12551922 
NCOR1KIAA1047 | MGC104216 | N-CoR | TRAC1 | hCIT529I10 | hN-CoRnuclear receptor co-repressor 1Affinity Capture-Western
Reconstituted Complex
BioGRID11466315 
NCOR2CTG26 | SMRT | SMRTE | SMRTE-tau | TNRC14 | TRAC-1 | TRAC1nuclear receptor co-repressor 2Affinity Capture-WesternBioGRID11466315 
PPARDFAAR | MGC3931 | NR1C2 | NUC1 | NUCI | NUCII | PPAR-beta | PPARBperoxisome proliferator-activated receptor deltaPPAR-delta interacts with HDAC7. This interaction was modelled on a demonstrated interaction between PPAR-delta and HDAC7 from unspecified sources.BIND12970571 
SFNYWHASstratifinAffinity Capture-MSBioGRID15778465 
ZBTB16PLZF | ZNF145zinc finger and BTB domain containing 16Reconstituted ComplexBioGRID11929873 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1508568621Ahsa-miR-150UCUCCCAACCCUUGUACCAGUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.