Gene Page: HMP19

Summary
GeneID  51617
Symbol  HMP19
Synonyms  -
Description  HMP19 protein
See related  Ensembl:ENSG00000170091|HPRD:13664|
Locus tag  -
Gene type  protein-coding
Map location  5q35.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.0276 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0050780dopamine receptor bindingIEAdopamine (GO term level: 6)-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007212dopamine receptor signaling pathwayIEAdopamine (GO term level: 8)-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005794Golgi apparatusIEA-
GO:0005768endosomeIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
GO:0031410cytoplasmic vesicleIEA-
GO:0030659cytoplasmic vesicle membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
C2orf18FLJ20555chromosome 2 open reading frame 18Two-hybridBioGRID16169070 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-142-5p156215681Ahsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-493-5p2282351A,m8hsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
miR-494240246m8hsa-miR-494brainUGAAACAUACACGGGAAACCUCUU
miR-496261267m8hsa-miR-496AUUACAUGGCCAAUCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.