Gene Page: C14orf166

Summary
GeneID  51637
Symbol  C14orf166
Synonyms  CGI-99|CGI99|CLE|CLE7|LCRP369|RLLM1
Description  chromosome 14 open reading frame 166
See related  HGNC:23169|MIM:610858|Ensembl:ENSG00000087302|HPRD:16615|
Locus tag  -
Gene type  protein-coding
Map location  14q22.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0114 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0042802identical protein bindingIPI15147888 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005737cytoplasmIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
C14orf166CGI-99 | CGI99 | CLE | CLE7 | LCRP369 | RLLM1chromosome 14 open reading frame 166CGI-99 interacts with CGI-99.BIND15147888 
NINKIAA1565ninein (GSK3B interacting protein)-HPRD15147888 
HNinein interacts with CGI-99.BIND15147888 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1861531591Ahsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-542-3p78841Ahsa-miR-542-3pUGUGACAGAUUGAUAACUGAAA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.