Gene Page: PPIL1

Summary
GeneID  51645
Symbol  PPIL1
Synonyms  CGI-124|CYPL1|MGC678|PPIase|hCyPX
Description  peptidylprolyl isomerase (cyclophilin)-like 1
See related  HGNC:9260|MIM:601301|Ensembl:ENSG00000137168|HPRD:03194|
Locus tag  -
Gene type  protein-coding
Map location  6p21.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.033 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.04433 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003755peptidyl-prolyl cis-trans isomerase activityIEA-
GO:0016853isomerase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006397mRNA processingIEA-
GO:0008380RNA splicingIEA-
GO:0006457protein foldingIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005681spliceosomeIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1825956021A,m8hsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-376c9359411Ahsa-miR-376cAACAUAGAGGAAAUUCCACG
miR-965966021Ahsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.