Gene Page: VPS24

Summary
GeneID  51652
Symbol  VPS24
Synonyms  CGI-149|CHMP3|NEDF
Description  vacuolar protein sorting 24 homolog (S. cerevisiae)
See related  HGNC:29865|MIM:610052|Ensembl:ENSG00000115561|HPRD:15650|
Locus tag  -
Gene type  protein-coding
Map location  2p24.3-p24.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0004 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0015031protein transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
GO:0016020membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
IGFBP7FSTL2 | IGFBP-7 | IGFBP-7v | IGFBPRP1 | MAC25 | PSFinsulin-like growth factor binding protein 7-HPRD,BioGRID11549700 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-130/30163701A,m8hsa-miR-130abrainCAGUGCAAUGUUAAAAGGGCAU
hsa-miR-301CAGUGCAAUAGUAUUGUCAAAGC
hsa-miR-130bbrainCAGUGCAAUGAUGAAAGGGCAU
hsa-miR-454-3pUAGUGCAAUAUUGCUUAUAGGGUUU
miR-142-3p66721Ahsa-miR-142-3pUGUAGUGUUUCCUACUUUAUGGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.