Gene Page: BRWD1
Summary ?
GeneID | 54014 |
Symbol | BRWD1 |
Synonyms | C21orf107|DCAF19|N143|WDR9 |
Description | bromodomain and WD repeat domain containing 1 |
Reference | HGNC:HGNC:12760|Ensembl:ENSG00000185658|HPRD:11683|Vega:OTTHUMG00000066030 |
Gene type | protein-coding |
Map location | 21q22.2 |
Pascal p-value | 0.01 |
DEG p-value | DEG:Sanders_2014:DS1_p=-0.210:DS1_beta=0.001850:DS2_p=9.29e-02:DS2_beta=-0.083:DS2_FDR=2.84e-01 |
Fetal beta | 1.145 |
DMG | 1 (# studies) |
eGene | Cortex Myers' cis & trans Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DEG:Sanders_2013 | Microarray | Whole-genome gene expression profiles using microarrays on lymphoblastoid cell lines (LCLs) from 413 cases and 446 controls. | |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
Expression | Meta-analysis of gene expression | P value: 1.469 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg21203420 | 21 | 40684731 | BRWD1 | -0.018 | 0.46 | DMG:Nishioka_2013 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs2261205 | chr5 | 180626340 | BRWD1 | 54014 | 0.06 | trans | ||
rs750788 | chr5 | 180638894 | BRWD1 | 54014 | 0.1 | trans | ||
rs16958358 | chr17 | 55502410 | BRWD1 | 54014 | 0.16 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IEA | - | |
GO:0030528 | transcription regulator activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006357 | regulation of transcription from RNA polymerase II promoter | IEA | - | |
GO:0006350 | transcription | IEA | - | |
GO:0008150 | biological_process | ND | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IDA | 16780588 | |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
HORIUCHI WTAP TARGETS UP | 306 | 188 | All SZGR 2.0 genes in this pathway |
BASAKI YBX1 TARGETS DN | 384 | 230 | All SZGR 2.0 genes in this pathway |
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL DN | 275 | 168 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
BIDUS METASTASIS DN | 161 | 93 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP | 633 | 376 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
DING LUNG CANCER EXPRESSION BY COPY NUMBER | 100 | 62 | All SZGR 2.0 genes in this pathway |
KUNINGER IGF1 VS PDGFB TARGETS UP | 82 | 51 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS UP | 317 | 208 | All SZGR 2.0 genes in this pathway |
DAIRKEE CANCER PRONE RESPONSE BPA | 51 | 35 | All SZGR 2.0 genes in this pathway |
MOLENAAR TARGETS OF CCND1 AND CDK4 UP | 67 | 48 | All SZGR 2.0 genes in this pathway |
MATZUK MEIOTIC AND DNA REPAIR | 39 | 26 | All SZGR 2.0 genes in this pathway |
PYEON CANCER HEAD AND NECK VS CERVICAL UP | 193 | 95 | All SZGR 2.0 genes in this pathway |
DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-122 | 2315 | 2321 | m8 | hsa-miR-122a | UGGAGUGUGACAAUGGUGUUUGU |
miR-124.1 | 873 | 879 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 872 | 879 | 1A,m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-125/351 | 90 | 96 | 1A | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
miR-130/301 | 159 | 165 | m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-132/212 | 144 | 151 | 1A,m8 | hsa-miR-212SZ | UAACAGUCUCCAGUCACGGCC |
hsa-miR-132brain | UAACAGUCUACAGCCAUGGUCG | ||||
miR-181 | 126 | 132 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-182 | 197 | 203 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-186 | 894 | 900 | 1A | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
miR-19 | 158 | 164 | m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-200bc/429 | 237 | 243 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-23 | 128 | 134 | m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-26 | 2550 | 2556 | 1A | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC | ||||
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-29 | 2275 | 2282 | 1A,m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-30-5p | 418 | 425 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG | ||||
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-323 | 128 | 134 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-376 | 112 | 119 | 1A,m8 | hsa-miR-376a | AUCAUAGAGGAAAAUCCACGU |
hsa-miR-376b | AUCAUAGAGGAAAAUCCAUGUU | ||||
miR-433-3p | 139 | 145 | m8 | hsa-miR-433brain | AUCAUGAUGGGCUCCUCGGUGU |
miR-7 | 834 | 840 | 1A | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
miR-96 | 196 | 203 | 1A,m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.