Gene Page: NLGN3
Summary ?
GeneID | 54413 |
Symbol | NLGN3 |
Synonyms | HNL3 |
Description | neuroligin 3 |
Reference | MIM:300336|HGNC:HGNC:14289|Ensembl:ENSG00000196338|HPRD:02275|Vega:OTTHUMG00000021790 |
Gene type | protein-coding |
Map location | Xq13.1 |
Sherlock p-value | 0.233 |
Fetal beta | -0.856 |
eGene | Myers' cis & trans |
Support | CELL ADHESION AND TRANSSYNAPTIC SIGNALING G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet Darnell FMRP targets Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs4889032 | chr16 | 79831327 | NLGN3 | 54413 | 0.15 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IPI | 17292328 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0050808 | synapse organization | IMP | neuron, Synap (GO term level: 5) | 15150161 |
GO:0007155 | cell adhesion | IEA | - | |
GO:0035176 | social behavior | IMP | 12669065 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0045202 | synapse | ISS | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
GO:0005737 | cytoplasm | IDA | 18029348 | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0009986 | cell surface | IDA | 15150161 |17292328 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CELL ADHESION MOLECULES CAMS | 134 | 93 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA PRONEURAL | 177 | 132 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-186 | 916 | 922 | 1A | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
miR-29 | 350 | 356 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-320 | 407 | 413 | 1A | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
miR-493-5p | 182 | 189 | 1A,m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
miR-539 | 941 | 947 | m8 | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.