SZGR2

Summary ?

GeneID	54413
Symbol	NLGN3
Synonyms	HNL3
Description	neuroligin 3
Reference	MIM:300336\|HGNC:HGNC:14289\|Ensembl:ENSG00000196338\|HPRD:02275\|Vega:OTTHUMG00000021790
Gene type	protein-coding
Map location	Xq13.1
Sherlock p-value	0.233
Fetal beta	-0.856
eGene	Myers' cis & trans
Support	CELL ADHESION AND TRANSSYNAPTIC SIGNALING G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet Darnell FMRP targets Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs4889032	chr16	79831327	NLGN3	54413		0.15		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		17292328
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0050808	synapse organization	IMP	neuron, Synap (GO term level: 5)	15150161
GO:0007155	cell adhesion	IEA		-
GO:0035176	social behavior	IMP		12669065
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0045202	synapse	ISS	neuron, Synap, Neurotransmitter, Glial (GO term level: 2)	-
GO:0005737	cytoplasm	IDA		18029348
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-
GO:0009986	cell surface	IDA		15150161 \|17292328

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CELL ADHESION MOLECULES CAMS	134	93	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL	177	132	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-186	916	922	1A	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-29	350	356	m8	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-320	407	413	1A	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-493-5p	182	189	1A,m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-539	941	947	m8	hsa-miR-539	GGAGAAAUUAUCCUUGGUGUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NLGN3