Gene Page: SSH1

Summary
GeneID  54434
Symbol  SSH1
Synonyms  FLJ38102|KIAA1298|SSH-1
Description  slingshot homolog 1 (Drosophila)
See related  HGNC:30579|MIM:606778|Ensembl:ENSG00000084112|HPRD:09486|
Locus tag  -
Gene type  protein-coding
Map location  12q24.11
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003779actin bindingIDA11832213 
GO:0005515protein bindingIPI17350576 
GO:0004725protein tyrosine phosphatase activityIEA-
GO:0016787hydrolase activityIEA-
GO:0008138protein tyrosine/serine/threonine phosphatase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0000902cell morphogenesisIMP14645219 
GO:0006470protein amino acid dephosphorylationIMP11832213 |14645219 
GO:0030036actin cytoskeleton organizationIMP11832213 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0042995cell projectionIEAaxon (GO term level: 4)-
GO:0005856cytoskeletonIEA-
GO:0005737cytoplasmIDA14645219 
GO:0005886plasma membraneIDA14645219 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACTBPS1TP5BP1actin, betaReconstituted ComplexBioGRID11832213 
CFL1CFLcofilin 1 (non-muscle)Unphosphorylated SSH-1L interacts with and dephosphorylates cofilin.BIND15660133 
DSTNACTDP | ADF | bA462D18.2destrin (actin depolymerizing factor)Biochemical ActivityBioGRID11832213 
LIMK1LIMKLIM domain kinase 1SSH-1S interacts with LIMK1.BIND15660133 
SSH-1L interacts with and dephosphorylates LIMK1.BIND15660133 
LIMK2-LIM domain kinase 2SSH-1L interacts with and dephosphorylates an unspecified isoform of LIMK2.BIND15660133 
PAK4-p21 protein (Cdc42/Rac)-activated kinase 4PAK4 interacts with and phosphorylates SSH-1L.BIND15660133 
YWHAZKCIP-1 | MGC111427 | MGC126532 | MGC138156tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptideSSH-1S interacts with 14-3-3-zeta.BIND15660133 
SSH-1L interacts with 14-3-3-zeta.BIND15660133 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
let-7/98429435m8hsa-let-7abrainUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrainUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrainUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrainAGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrainUGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrainUGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brainUGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZUGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrainUGAGGUAGUAGUUUGUGCUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.