Gene Page: NSMCE4A

Summary
GeneID  54780
Symbol  NSMCE4A
Synonyms  C10orf86|FLJ20003|NSE4A|RP11-500G22.3|bA500G22|bA500G22.3
Description  non-SMC element 4 homolog A (S. cerevisiae)
See related  HGNC:25935|Ensembl:ENSG00000107672|HPRD:16585|
Locus tag  -
Gene type  protein-coding
Map location  10q26.13
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.03487 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-221/222108114m8hsa-miR-221brainAGCUACAUUGUCUGCUGGGUUUC
hsa-miR-222brainAGCUACAUCUGGCUACUGGGUCUC
miR-485-3p6672m8hsa-miR-485-3pGUCAUACACGGCUCUCCUCUCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.