Gene Page: KCTD9
Summary ?
| GeneID | 54793 |
| Symbol | KCTD9 |
| Synonyms | BTBD27 |
| Description | potassium channel tetramerization domain containing 9 |
| Reference | HGNC:HGNC:22401|Ensembl:ENSG00000104756|HPRD:13772|Vega:OTTHUMG00000099428 |
| Gene type | protein-coding |
| Map location | 8p21.1 |
| Pascal p-value | 0.817 |
| Sherlock p-value | 0.775 |
| Fetal beta | -1.097 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| DMG:vanEijk_2014 | Genome-wide DNA methylation analysis | This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). | 1 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.00057 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03086 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg07149772 | 8 | 25314972 | KCTD9 | 0.009 | 2.546 | DMG:vanEijk_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs5990879 | chrX | 20517507 | KCTD9 | 54793 | 0.17 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IEA | - | |
| GO:0005249 | voltage-gated potassium channel activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006813 | potassium ion transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - | |
| GO:0008076 | voltage-gated potassium channel complex | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| BENPORATH CYCLING GENES | 648 | 385 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
| LEIN MIDBRAIN MARKERS | 82 | 55 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY E2F4 UNSTIMULATED | 728 | 415 | All SZGR 2.0 genes in this pathway |
| AMBROSINI FLAVOPIRIDOL TREATMENT TP53 | 109 | 63 | All SZGR 2.0 genes in this pathway |
| WHITFIELD CELL CYCLE G2 | 182 | 102 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
| ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-153 | 1455 | 1461 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
| hsa-miR-153 | UUGCAUAGUCACAAAAGUGA | ||||
| miR-203.1 | 1647 | 1653 | 1A | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
| miR-217 | 412 | 419 | 1A,m8 | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
| miR-218 | 374 | 381 | 1A,m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
| miR-320 | 481 | 487 | 1A | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
| miR-431 | 1575 | 1581 | 1A | hsa-miR-431 | UGUCUUGCAGGCCGUCAUGCA |
| miR-448 | 383 | 390 | 1A,m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
| hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.