Gene Page: ST7L
Summary ?
| GeneID | 54879 |
| Symbol | ST7L |
| Synonyms | FAM4B|ST7R|STLR |
| Description | suppression of tumorigenicity 7 like |
| Reference | HGNC:HGNC:18441|Ensembl:ENSG00000007341|HPRD:18112|Vega:OTTHUMG00000011753 |
| Gene type | protein-coding |
| Map location | 1p13.2 |
| Pascal p-value | 1.635E-4 |
| eGene | Anterior cingulate cortex BA24 Caudate basal ganglia Cerebellum |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0235 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs5777126 | 1 | 113096840 | ST7L | ENSG00000007341.14 | 1.45367E-6 | 0.02 | 66607 | gtex_brain_ba24 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| TRAF2 | 0.88 | 0.90 |
| STK11 | 0.87 | 0.88 |
| LONP1 | 0.87 | 0.88 |
| MAD1L1 | 0.86 | 0.89 |
| CTBP1 | 0.86 | 0.89 |
| MIER2 | 0.86 | 0.88 |
| RANBP3 | 0.86 | 0.88 |
| LRRC4B | 0.86 | 0.89 |
| PANK4 | 0.86 | 0.87 |
| NADK | 0.86 | 0.87 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.72 | -0.73 |
| AF347015.21 | -0.71 | -0.77 |
| MT-CO2 | -0.70 | -0.72 |
| AF347015.33 | -0.68 | -0.70 |
| AF347015.8 | -0.67 | -0.71 |
| AF347015.27 | -0.67 | -0.72 |
| MT-CYB | -0.66 | -0.69 |
| AF347015.2 | -0.64 | -0.67 |
| AF347015.15 | -0.63 | -0.68 |
| HIGD1B | -0.62 | -0.66 |
Section III. Gene Ontology annotation
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| WAMUNYOKOLI OVARIAN CANCER LMP DN | 199 | 124 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| MOHANKUMAR TLX1 TARGETS DN | 193 | 112 | All SZGR 2.0 genes in this pathway |
| RICKMAN HEAD AND NECK CANCER E | 89 | 44 | All SZGR 2.0 genes in this pathway |
| CERVERA SDHB TARGETS 1 UP | 118 | 66 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS LATE PROGENITOR | 544 | 307 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
| KORKOLA EMBRYONIC CARCINOMA VS SEMINOMA DN | 25 | 14 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-135 | 1783 | 1789 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
| hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
| miR-185 | 1533 | 1540 | 1A,m8 | hsa-miR-185brain | UGGAGAGAAAGGCAGUUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.