Gene Page: RHBDL2
Summary ?
| GeneID | 54933 |
| Symbol | RHBDL2 |
| Synonyms | RRP2 |
| Description | rhomboid, veinlet-like 2 (Drosophila) |
| Reference | MIM:608962|HGNC:HGNC:16083|Ensembl:ENSG00000158315|HPRD:07151| |
| Gene type | protein-coding |
| Map location | 1p34.3 |
| Pascal p-value | 0.034 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| PSEN2 | 0.89 | 0.89 |
| ACOT7 | 0.89 | 0.89 |
| PPP2R5B | 0.87 | 0.87 |
| ATP13A2 | 0.87 | 0.88 |
| SYNGR3 | 0.86 | 0.89 |
| SYT3 | 0.86 | 0.88 |
| ATP1A3 | 0.85 | 0.88 |
| STMN3 | 0.84 | 0.86 |
| CHPF | 0.84 | 0.87 |
| SEZ6L2 | 0.84 | 0.90 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.21 | -0.53 | -0.46 |
| AF347015.2 | -0.53 | -0.43 |
| AF347015.8 | -0.53 | -0.45 |
| MT-CO2 | -0.52 | -0.45 |
| AP002478.3 | -0.52 | -0.54 |
| AF347015.33 | -0.52 | -0.44 |
| AF347015.31 | -0.51 | -0.44 |
| AC098691.2 | -0.50 | -0.51 |
| NOSTRIN | -0.50 | -0.46 |
| AF347015.26 | -0.50 | -0.41 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004252 | serine-type endopeptidase activity | IEA | glutamate (GO term level: 7) | - |
| GO:0008233 | peptidase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007165 | signal transduction | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
| LIN SILENCED BY TUMOR MICROENVIRONMENT | 108 | 73 | All SZGR 2.0 genes in this pathway |
| WINNEPENNINCKX MELANOMA METASTASIS UP | 162 | 86 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
| CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-361 | 672 | 678 | 1A | hsa-miR-361brain | UUAUCAGAAUCUCCAGGGGUAC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.