Gene Page

Gene Page: WDYHV1

Summary

GeneID

55093

Symbol

WDYHV1

Synonyms

C8orf32|FLJ10204

Description

WDYHV motif containing 1

Locus tag

Gene type

protein-coding

Map location

8q24.13

Gene in Data Sources

Gene set name

Method of gene set

Evidence

Info

Network

Shortest path distance of core genes in the Human protein-protein interaction network

Contribution to shortest path in PPI network: 0.0709

General Gene Expression (microarray) ?

Gene Expression in Brain Regions (new)

Top co-expressed genes in Brain Regions (new)

Gene

Pearson's Correlation

Spearman's Correlation

Top 10 positively co-expressed genes

Top 10 negatively co-expressed genes

Protein-protein Interactions

Shown by network

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
CBFA2T2	DKFZp313F2116 \| EHT \| MTGR1 \| ZMYND3	core-binding factor, runt domain, alpha subunit 2; translocated to, 2	Two-hybrid	BioGRID	16189514
HPRT1	HGPRT \| HPRT	hypoxanthine phosphoribosyltransferase 1	Two-hybrid	BioGRID	16189514
HSD17B14	DHRS10 \| retSDR3	hydroxysteroid (17-beta) dehydrogenase 14	Two-hybrid	BioGRID	16189514
JUP	ARVD12 \| CTNNG \| DP3 \| DPIII \| PDGB \| PKGB	junction plakoglobin	Two-hybrid	BioGRID	16189514
MDFI	I-MF \| I-mfa	MyoD family inhibitor	Two-hybrid	BioGRID	16189514
NECAB2	EFCBP2	N-terminal EF-hand calcium binding protein 2	Two-hybrid	BioGRID	16189514
NME1	AWD \| GAAD \| NB \| NBS \| NDPK-A \| NDPKA \| NM23 \| NM23-H1	non-metastatic cells 1, protein (NM23A) expressed in	Two-hybrid	BioGRID	16189514
PCBD1	DCOH \| PCBD \| PCD \| PHS	pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha	Two-hybrid	BioGRID	16189514
PLDN	PA \| PALLID	pallidin homolog (mouse)	Two-hybrid	BioGRID	16189514
RABAC1	PRA1 \| PRAF1 \| YIP3	Rab acceptor 1 (prenylated)	Two-hybrid	BioGRID	16189514
RBBP8	CTIP \| RIM	retinoblastoma binding protein 8	Two-hybrid	BioGRID	16189514
RPIA	RPI	ribose 5-phosphate isomerase A	Two-hybrid	BioGRID	16189514
SFN	YWHAS	stratifin	Two-hybrid	BioGRID	16189514
SMN1	BCD541 \| SMA \| SMA1 \| SMA2 \| SMA3 \| SMA4 \| SMA@ \| SMN \| SMNT \| T-BCD541	survival of motor neuron 1, telomeric	Two-hybrid	BioGRID	16189514
TRIP13	16E1BP	thyroid hormone receptor interactor 13	Two-hybrid	BioGRID	16189514
XIAP	API3 \| BIRC4 \| ILP1 \| MIHA \| XLP2	X-linked inhibitor of apoptosis	Two-hybrid	BioGRID	16189514
XTP3TPA	CDA03 \| MGC5627 \| RS21C6	XTP3-transactivated protein A	Two-hybrid	BioGRID	16189514

miRNA Targets ?

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-200bc/429	496	502	1A	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.