Gene Page: ARHGAP17

Summary
GeneID  55114
Symbol  ARHGAP17
Synonyms  DKFZp564A1363|FLJ37567|FLJ43368|MGC87805|MST066|MST110|MSTP038|MSTP066|MSTP110|NADRIN|RICH1|WBP15
Description  Rho GTPase activating protein 17
See related  HGNC:18239|MIM:608293|Ensembl:ENSG00000140750|HPRD:12207|
Locus tag  -
Gene type  protein-coding
Map location  16p12.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01775 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005096GTPase activator activityIEA-
GO:0005515protein bindingIEA-
GO:0017124SH3 domain bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007165signal transductionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005923tight junctionIEABrain (GO term level: 10)-
GO:0005622intracellularIEA-
GO:0005737cytoplasmIEA-
GO:0016020membraneIEA-
GO:0030054cell junctionIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ABL1ABL | JTK7 | bcr/abl | c-ABL | p150 | v-ablc-abl oncogene 1, receptor tyrosine kinaseReconstituted ComplexBioGRID11431473 
BTKAGMX1 | AT | ATK | BPK | IMD1 | MGC126261 | MGC126262 | PSCTK1 | XLABruton agammaglobulinemia tyrosine kinaseReconstituted ComplexBioGRID11431473 
CDC42CDC42Hs | G25Kcell division cycle 42 (GTP binding protein, 25kDa)Biochemical ActivityBioGRID11431473 
CRKCRKIIv-crk sarcoma virus CT10 oncogene homolog (avian)Reconstituted ComplexBioGRID11431473 
CTTNEMS1 | FLJ34459cortactinReconstituted ComplexBioGRID11431473 
FNBP1FBP17 | KIAA0554 | MGC126804formin binding protein 1Reconstituted ComplexBioGRID11431473 
GRB2ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084growth factor receptor-bound protein 2Reconstituted ComplexBioGRID11431473 
LCKYT16 | p56lck | pp58lcklymphocyte-specific protein tyrosine kinaseReconstituted ComplexBioGRID11431473 
PACSIN1KIAA1379 | SDPIprotein kinase C and casein kinase substrate in neurons 1Reconstituted ComplexBioGRID11431473 
PIK3R1GRB1 | p85 | p85-ALPHAphosphoinositide-3-kinase, regulatory subunit 1 (alpha)Reconstituted ComplexBioGRID11431473 
RAC1MGC111543 | MIG5 | TC-25 | p21-Rac1ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)Biochemical ActivityBioGRID11431473 
SH3GLB1Bif-1 | CGI-61 | KIAA0491 | dJ612B15.2SH3-domain GRB2-like endophilin B1Reconstituted ComplexBioGRID11431473 
SRCASV | SRC1 | c-SRC | p60-Srcv-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)Reconstituted ComplexBioGRID11431473 
TRIP10CIP4 | HSTP | STOT | STPthyroid hormone receptor interactor 10-HPRD,BioGRID11431473 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-103/1074774831Ahsa-miR-103brainAGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brainAGCAGCAUUGUACAGGGCUAUCA
miR-1534014071Ahsa-miR-153UUGCAUAGUCACAAAAGUGA
miR-1822352411Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-26666672m8hsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
miR-4484014071Ahsa-miR-448UUGCAUAUGUAGGAUGUCCCAU
miR-544480486m8hsa-miR-544AUUCUGCAUUUUUAGCAAGU
miR-962352411Ahsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.