Gene Page: AKIRIN2

Summary
GeneID  55122
Symbol  AKIRIN2
Synonyms  C6orf166|FBI1|FLJ10342|dJ486L4.2
Description  akirin 2
See related  HGNC:21407|Ensembl:ENSG00000135334|HPRD:12864|
Locus tag  -
Gene type  protein-coding
Map location  6q15
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CCDC85BDIPAcoiled-coil domain containing 85BTwo-hybridBioGRID16189514 
LNX1LNX | MPDZ | PDZRN2ligand of numb-protein X 1Two-hybridBioGRID16189514 
SPG21ACP33 | BM-019 | GL010 | MASPARDIN | MASTspastic paraplegia 21 (autosomal recessive, Mast syndrome)Two-hybridBioGRID16189514 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1393283351A,m8hsa-miR-139brainUCUACAGUGCACGUGUCU
miR-2793991Ahsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-4901021081Ahsa-miR-490CAACCUGGAGGACUCCAUGCUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.