Gene Page: STEAP3

Summary
GeneID  55240
Symbol  STEAP3
Synonyms  STMP3|TSAP6|dudlin-2
Description  STEAP family member 3
See related  HGNC:24592|MIM:609671|Ensembl:ENSG00000115107|HPRD:10285|
Locus tag  -
Gene type  protein-coding
Map location  2q14.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00755 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005488bindingIEA-
GO:0005506iron ion bindingIEA-
GO:0005507copper ion bindingIEA-
GO:0009055electron carrier activityIEA-
GO:0016491oxidoreductase activityIEA-
GO:0046872metal ion bindingIEA-
GO:0050660FAD bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007049cell cycleIEA-
GO:0006826iron ion transportIEA-
GO:0006811ion transportIEA-
GO:0006915apoptosisIEA-
GO:0055114oxidation reductionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005768endosomeIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
GO:0010008endosome membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
BNIP3LBNIP3a | NIXBCL2/adenovirus E1B 19kDa interacting protein 3-like-HPRD,BioGRID12606722 
PKMYT1DKFZp547K1610 | FLJ20093 | MYT1protein kinase, membrane associated tyrosine/threonine 1-HPRD,BioGRID12606722 
TPT1FLJ27337 | HRF | TCTP | p02tumor protein, translationally-controlled 1-HPRD15319436 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/506838844m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-128834840m8hsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.