Gene Page: PPP2R5D

Summary
GeneID  5528
Symbol  PPP2R5D
Synonyms  B56D|MGC2134|MGC8949
Description  protein phosphatase 2, regulatory subunit B', delta isoform
See related  HGNC:9312|MIM:601646|Ensembl:ENSG00000112640|HPRD:09039|
Locus tag  -
Gene type  protein-coding
Map location  6p21.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.033 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.04433 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI16189514 |17110335 |17540176 
GO:0008601protein phosphatase type 2A regulator activityTAS8703017 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007399nervous system developmentTASneurite (GO term level: 5)8703017 
GO:0007165signal transductionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000159protein phosphatase type 2A complexIEA-
GO:0005634nucleusTAS8703017 
GO:0005737cytoplasmIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARL2ARFL2ADP-ribosylation factor-like 2Co-purificationBioGRID12912990 
HAND1Hxt | Thing1 | bHLHa27 | eHandheart and neural crest derivatives expressed 1Two-hybridBioGRID14636580 
HAND2DHAND2 | FLJ16260 | Hed | MGC125303 | MGC125304 | Thing2 | bHLHa26 | dHandheart and neural crest derivatives expressed 2-HPRD,BioGRID14636580 
NEK1DKFZp686D06121 | DKFZp686K12169 | KIAA1901 | MGC138800 | NY-REN-55NIMA (never in mitosis gene a)-related kinase 1NEK1 interacts with PP2A.BIND14690447 
PPFIA1FLJ41337 | FLJ42630 | FLJ43474 | LIP.1 | LIP1 | LIPRIN | MGC26800protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1Affinity Capture-Western
Two-hybrid
BioGRID16189514 
PPP2CAPP2Ac | PP2CA | RP-Cprotein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoformAffinity Capture-MSBioGRID18782753 
PPP2CBPP2CBprotein phosphatase 2 (formerly 2A), catalytic subunit, beta isoformAffinity Capture-MSBioGRID18782753 
PPP2R1AMGC786 | PR65Aprotein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoformAffinity Capture-MSBioGRID18782753 
PPP4CPP4 | PPH3 | PPXprotein phosphatase 4 (formerly X), catalytic subunitAffinity Capture-MSBioGRID18715871 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-133720726m8hsa-miR-133aUUGGUCCCCUUCAACCAGCUGU
hsa-miR-133bUUGGUCCCCUUCAACCAGCUA
miR-185381387m8hsa-miR-185brainUGGAGAGAAAGGCAGUUC
miR-493-5p10231029m8hsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
miR-9427433m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.