Gene Page: WDR33

Summary
GeneID  55339
Symbol  WDR33
Synonyms  FLJ11294|WDC146
Description  WD repeat domain 33
See related  HGNC:25651|Ensembl:ENSG00000136709|HPRD:11680|
Locus tag  -
Gene type  protein-coding
Map location  2q14.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.023 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00755 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0455 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI17353931 
GO:0005215transporter activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006301postreplication repairNAS11162572 
GO:0007283spermatogenesisNAS11162572 
GO:0006810transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIDA11162572 
GO:0005634nucleusIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
C7orf64DKFZP564O0523 | DKFZp686D1651 | HSPC304chromosome 7 open reading frame 64Two-hybridBioGRID16169070 
EEF1GEF1G | GIG35eukaryotic translation elongation factor 1 gammaTwo-hybridBioGRID16169070 
GIT1-G protein-coupled receptor kinase interacting ArfGAP 1Two-hybridBioGRID16169070 
MYST2HBO1 | HBOA | KAT7MYST histone acetyltransferase 2Two-hybridBioGRID16169070 
PFN2D3S1319E | PFLprofilin 2Two-hybridBioGRID16169070 
PRMT1ANM1 | HCP1 | HRMT1L2 | IR1B4protein arginine methyltransferase 1Two-hybridBioGRID16169070 
RNPS1E5.1 | MGC117332RNA binding protein S1, serine-rich domainAffinity Capture-MSBioGRID17353931 
SH3GL3CNSA3 | EEN-2B-L3 | EEN-B2 | HsT19371 | SH3D2C | SH3P13SH3-domain GRB2-like 3Two-hybridBioGRID16169070 
TGFBR1AAT5 | ACVRLK4 | ALK-5 | ALK5 | LDS1A | LDS2A | SKR4 | TGFR-1transforming growth factor, beta receptor 1TGF-beta-RI interacts with FLJ11294. This interaction was modeled on a demonstrated interaction between human TGF-beta-RI and mouse Wdr33.BIND15761153 
TP53FLJ92943 | LFS1 | TRP53 | p53tumor protein p53Two-hybridBioGRID16169070 
UTP14AKIAA0266 | NY-CO-16 | SDCCAG16 | dJ537K23.3UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)Two-hybridBioGRID16169070 
ZBTB16PLZF | ZNF145zinc finger and BTB domain containing 16Two-hybridBioGRID16169070 
ZHX1-zinc fingers and homeoboxes 1Two-hybridBioGRID16169070 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-493-5p243024361Ahsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.