Gene Page: PPP5C

Summary
GeneID  5536
Symbol  PPP5C
Synonyms  FLJ36922|PP5|PPP5
Description  protein phosphatase 5, catalytic subunit
See related  HGNC:9322|MIM:600658|Ensembl:ENSG00000011485|HPRD:02805|
Locus tag  -
Gene type  protein-coding
Map location  19q13.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.7977 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004871signal transducer activityIMP12761501 
GO:0005506iron ion bindingIEA-
GO:0005515protein bindingIPI14764652 
GO:0004722protein serine/threonine phosphatase activityTAS7925273 
GO:0004721phosphoprotein phosphatase activityIEA-
GO:0016787hydrolase activityIEA-
GO:0030145manganese ion bindingIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006350transcriptionTAS7925273 
GO:0006470protein amino acid dephosphorylationTAS7925273 
GO:0007067mitosisTAS7925273 
GO:0043123positive regulation of I-kappaB kinase/NF-kappaB cascadeIMP12761501 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005829cytosolIEA-
GO:0005634nucleusTAS7925273 
GO:0005737cytoplasmIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CDC16APC6cell division cycle 16 homolog (S. cerevisiae)-HPRD9405394 
CDC27APC3 | CDC27Hs | D0S1430E | D17S978E | HNUCcell division cycle 27 homolog (S. cerevisiae)-HPRD,BioGRID9405394 
CPNE1COPN1 | CPN1 | MGC1142copine I-HPRD12522145 
CPNE2COPN2 | CPN2 | DKFZp686E06199 | MGC16924copine II-HPRD12522145 
CPNE4COPN4 | CPN4 | MGC15604copine IV-HPRD12522145 
CRY2FLJ10332 | HCRY2 | KIAA0658 | PHLL2cryptochrome 2 (photolyase-like)-HPRD,BioGRID9383998 
CSE1LCAS | CSE1 | MGC117283 | MGC130036 | MGC130037 | XPO2CSE1 chromosome segregation 1-like (yeast)Two-hybridBioGRID16169070 
GNA12MGC104623 | MGC99644 | NNX3 | RMP | gepguanine nucleotide binding protein (G protein) alpha 12-HPRD,BioGRID12176367 
GNA13G13 | MGC46138guanine nucleotide binding protein (G protein), alpha 13GNA13 (alpha-13) interacts with PPP5C (PP5).BIND15735747 
-HPRD,BioGRID12176367 
HSP90AA1FLJ31884 | HSP86 | HSP89A | HSP90A | HSP90N | HSPC1 | HSPCA | HSPCAL1 | HSPCAL4 | HSPN | Hsp89 | Hsp90 | LAP2heat shock protein 90kDa alpha (cytosolic), class A member 1-HPRD10400612 
Hsp90 interacts with PP5. This interaction was modeled on a demonstrated interaction between human Hsp90 and PP5 from an unspecified species.BIND15664193 
MAP3K5ASK1 | MAPKKK5 | MEKK5mitogen-activated protein kinase kinase kinase 5-HPRD,BioGRID11689443 
PPP2R1AMGC786 | PR65Aprotein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform-HPRD11504734 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1373333401A,m8hsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-365245251m8hsa-miR-365UAAUGCCCCUAAAAAUCCUUAU
miR-5043713771Ahsa-miR-504AGACCCUGGUCUGCACUCUAU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.